Exploring the Scientific Connotation of Gypsum in Baihu Decoction Compatibility with Heat-clearing Effect Based on Phase Composition

Abstract

Objective

This study aimed to study the effects of different crystalline states of Sheng Shigao (raw gypsum, RG) and its inorganic elements on the antipyretic efficacy of Baihu Decoction (BHT).

Methods

RG samples calcined at different temperatures were prepared. The phase composition of RG and Duan Shigao (calcination of gypsum, CG) as well as the changes in phase composition before and after adding water to RG calcined at specific temperatures, were determined using X-ray diffraction (XRD). A fever model was established by subcutaneously injecting 20% yeast suspension (10 mL·kg⁻¹) into the backs of rats. The effects of BHT containing RG in different crystalline states on rat body temperature were measured. Serum levels of IL-1β, IL-6, and hypothalamic prostaglandin E2 (PGE₂) were detected using ELISA. Serum Ca²⁺ levels were measured using a microplate method. The content of trace elements in RG and CG and the corresponding freeze-dried BHT powder was determined using inductively coupled plasma mass spectrometry (ICP-MS). The complexation of representative inorganic elements with mangiferin, a major active component in BHT, was investigated using UV-Vis spectroscopy and fluorescence spectroscopy. A validation model was established using RAW264.7 mouse macrophages. Drug-containing serum of BHT with different inorganic elements was prepared, and the nitric oxide (NO) levels in the cell supernatant of different treatment groups were measured using the Griess method. The mRNA levels of IL-6, TNF-α, and PGE₂ in each group were detected using qPCR (real-time fluorescent quantitative PCR).

Results

After calcination, the phase composition of RG changed, and the content of inorganic elements in RG, CG170 (RG calcined at 170 °C), and CG350 (RG calcined at 350 °C) showed similar trends. Compared with RG, the content of Ca, Sr, Al, and Na in CG changed significantly. Compared with BHT, the content of Ca, Sr, Si, and Na in CG changed significantly when incorporated into the formula. Intermolecular interactions confirmed strong binding between mangiferin and Cu²⁺ and Al³⁺. Cu²⁺ and Fe³⁺ exhibited fluorescence quenching effects on mangiferin solution, while Al³⁺ and Zn²⁺ showed strong fluorescence enhancement, with fluorescence intensity increasing by 120-fold and 30-fold, respectively. In vitro evaluation of synergistic anti-inflammatory effects confirmed that Ca, Fe, Cr, Al, and Si exhibited synergistic anti-inflammatory effects.

Conclusion

The crystalline state of RG has little effect on its antipyretic properties, while Ca, Sr, Na, Fe, and Al are likely the key material bases influencing its efficacy.

Keywords

gypsum - Baihu Decoction - heat-clearing - compatibility of medicines - phase composition

Introduction

Raw gypsum (RG) was first documented in Shennong's Classic of Materia Medica (Shennong Ben Cao Jing). According to the Pharmacopoeia of the People's Republic of China,[1] RG is described as sweet, pungent, and highly cold in nature, pertaining to the lung and stomach meridians. It has the functions of clearing heat, purging fire, relieving irritability, and quenching thirst. The commonly used processed forms in clinical practice are Sheng Shigao (RG) and Duan Shigao (calcination of gypsum, CG). After calcination, the properties of RG change; CG is characterized as sweet, pungent, astringent, and cold in nature, also pertaining to the lung and stomach meridians. It is used to dry dampness, promote tissue regeneration, heal sores, and stop bleeding. The main component of RG is hydrated calcium sulfate (CaSO₄·2H₂O), while the main component of CG is anhydrous calcium sulfate (CaSO₄). Despite the difference of only two water molecules in their crystalline structure, their therapeutic effects are entirely different. Current research on the material basis of RG's efficacy primarily focuses on two aspects: (1) types, content, and forms of elements contained in RG; and (2) various reactions that occur when RG is combined with other medicinal substances.

Traditional Chinese medicine (TCM) emphasizes the importance of compatibility, and clinical practice often involves the use of herbal formulas. Therefore, this study selected Baihu Decoction (BHT), a commonly used antipyretic formula in clinical practice, as the research subject. The X-ray diffraction (XRD) method was used to analyze the phase composition of RG and CG,[2] and clarify the structural changes before and after calcination. Inductively coupled plasma mass spectrometry (ICP-MS) was employed to perform semiquantitative analysis of RG, CG, and the samples incorporated into BHT to compare the differences in the content of associated inorganic elements.

In TCM, organic and inorganic components coexist. From the perspective of coordination chemistry, organic components contain functional groups such as hydroxyl, amino, carboxyl, and carbonyl groups, which can form complexes with trace elements. This study preliminarily explores the coordination relationship between certain inorganic elements and mangiferin, a major active component in BHT, using UV-Vis spectroscopy and fluorescence spectroscopy. Additionally, the in vitro synergistic anti-inflammatory effects of drug-containing serum from Baihu Decoction with different inorganic elements were investigated. This lays the foundation for studying the relationship between trace elements and other chemical components, the forms and states of trace elements, and revealing the scientific connotation of RG's heat-clearing effect.

Materials

Cells and Animals

The mouse macrophage cell line RAW264.7 was purchased from Wuhan Sunncell Co., Ltd. Healthy male Sprague–Dawley (SD) rats, weighing 180 to 220 g, were provided by Jinan Pengyue Experimental Animal Breeding Co., Ltd. (Production License No.: SCXK [Lu] 2022-0006; Animal Quality Certificate Nos.: No. 370726221101045473, No. 370726231100076557). This animal experiment was approved by the Animal Ethics Committee of Henan University of Chinese Medicine (Ethics Approval No.: DWLLGZR202303182).

Drugs and Reagents

RG (Anhui Tuoyuantang Pharmaceutical Co., Ltd., Batch No.: 02-210501011); Zhimu (Anemarrhena Rhizome; Hunan Hongrui Traditional Chinese Medicine Pieces Co., Ltd., Batch No.: 20220601); Zhigancao (Glycyrrhizae Radix et Rhizoma Praeparata cum Melle), and Jingmi (Semen Oryzae Sativae; Bozhou Zhang Zhongjing Traditional Chinese Medicine Pieces Co., Ltd., Batch Nos.: 02-22010101, 220901); aspirin enteric-coated tablets (Bayer Healthcare Co., Ltd., Batch No.: BJ65368); active dry yeast (Angel Yeast Co., Ltd., Batch No.: 20230118); sodium pentobarbital (Sinopharm Chemical Reagent Co., Ltd., Batch No.: 69020100); anhydrous calcium sulfate and silicon dioxide (purity ≥99.99%, Shanghai Aladdin Biochemical Technology Co., Ltd., Batch Nos.: J2217137, I2226361); ferric oxide, chromium oxide, aluminum oxide, 98% ethylenediamine dihydrochloride, and 99.5% sulfanilamide (purity 99.99%, Shanghai Macklin Biochemical Co., Ltd., Batch Nos.: C14773969, C15459740, C14495696, C15789835, C15268812); lipopolysaccharide (LPS), rat calcium assay kit, and total RNA extraction reagent (Beijing Solarbio Science & Technology Co., Ltd., Batch Nos.: 2230508001, 20230511, 240001001); Interferon-γ (IFN-γ; Suzhou Jin'an Protein Technology Co., Ltd., Product No.: C746); Primers for M-GAPDH, M-IL6 (2), M-TNFα (5), and M-Ptger2 (1), as well as SweScript All-in-One RT SuperMix for qPCR and 2× Universal Blue SYBR Green qPCR Master Mix (Wuhan Servicebio Technology Co., Ltd., Batch Nos.: NM_008084.2, NM_001314054.1, NM_001278601.1, NM_008964.4, MPC2311007, MPC2310001); rat interleukin-1β (IL-1β), IL-6, and prostaglandin E2 (PGE₂) ELISA kits (Jiangsu Meimian Industrial Co., Ltd., Batch Nos.: 202305, 202305, 202304); Cell Counting Kit-8 (CCK-8, Dalian Meilunbio Technology Co., Ltd., Batch No.: MA0218-Oct-24I); and double-distilled water was used throughout the experiments.

Instruments

Smartlab 9kw powder X-ray diffractometer (Rigaku, Japan); YSD-4-10D box-type resistance furnace (Shanghai Yao's Instrument Factory, China); Agilent 7500a inductively coupled plasma mass spectrometer (Agilent Technologies Inc.); SW-2 microwave digestion system (Shanghai Yiyao Instrument Technology Development Co., Ltd., China); Cytation 3 multifunctional microplate reader (BioTek Instruments Inc.); KF-PRO-005 pathological slide scanner (Ningbo Jiangfeng Biological Information Technology Co., Ltd., China); Applied Biosystems™ QuantStudio™ 6 and 7 Flex real-time quantitative PCR systems (Thermo Fisher Scientific)

Methods

X-Ray Diffraction Analysis of Phase Composition of Raw Gypsum and Calcination of Gypsum

Experimental Conditions

Cu Ka radiation was used with a graphite monochromator, tube voltage of 30 kV, tube current of 15 mA, scanning rate of 5 degrees/minute, and 2θ scanning range of 5 to 60 degrees.

Sample Preparation and Detection

RG: RG pieces were crushed and sieved through a 100-mesh sieve. CG[3]: Different calcined RG samples were prepared at various temperatures based on literature references and named CG110, CG140, CG170, CG200, CG250, CG300, CG350, CG400, CG450, and CG750. Appropriate amounts of these samples were taken and analyzed under the experimental conditions described above.

X-Ray Diffraction Analysis of Phase Composition of Calcination of Gypsum at Specific Temperatures before and after Water Addition

Experimental Conditions

Same as described “2.1.1”.

Sample Preparation and Detection

Calcined RG samples at specific temperatures and CaSO₄ were selected, ground with water until hardened, and named CG170 + H₂O, CG350 + H₂O, CG750 + H₂O, and CaSO₄+ H₂O. Appropriate amounts of these samples were taken and analyzed under the experimental conditions described “2.1.1”.

Study on the Antipyretic Effects of Raw Gypsum in Different Crystalline States in Baihu Decoction

Preparation of Medicinal Solutions

Baihu Decoction

Considering the low solubility of calcium sulfate, the preparation was modified based on modern clinical dosage conversion and literature records.[4] [5] [6] RG (250 g, wrapped in gauze), Zhimu (Anemarrhena Rhizome; 93.76 g), and Gancao (Glycyrrhizae Radix et Rhizoma; 31.25 g) were soaked in 2 L of distilled water for 30 minutes. Jingmi (120 mL, ∼104 g) was added to the pot, and the water level was marked. The mixture was brought to a boil over high heat and then simmered over low heat with occasional stirring. Water was replenished every 2 minutes. After 20 minutes of decoction, the mixture was filtered and adjusted to a final volume of 600 mL. The supernatant was collected after standing at room temperature for 30 minutes, appropriately concentrated, and freeze-dried. The dried product was stored at −20 °C for later use.

Other formulas

RG was replaced with the prepared samples, while the other steps remained the same as for BHT. These formulas were named CG170-BHT, CG350-BHT, (CG170 + H₂O)-BHT, and (CG350 + H₂O)-BHT.

Aspirin solution

Two 0.1 g aspirin enteric-coated tablets were ground into a fine powder, dissolved in water, and adjusted to a final volume of 20 mL.

Animal Modeling, Grouping, and Administration

After 1 week of adaptive feeding, SD rats, except for the blank control group (Control), were subcutaneously injected with a 20% dry yeast suspension at a dose of 10 mL·kg⁻¹ on their backs. The control group received an equivalent volume of normal saline. The model was considered successful when the body temperature of the modeled rats was significantly higher than that of the control group.

The successfully modeled rats were randomly divided into the following groups: model group (Model), positive drug group (Positive), BHT group, and groups with RG processed at specific temperatures (CG170-BHT, CG350-BHT) and groups with RG processed at specific temperatures followed by water addition ([CG170 + H₂O]-BHT, [CG350 + H₂O]-BHT). The administration began 5 hours after successful modeling. The Positive group received a dose of 100 mg·kg⁻¹ (calculated based on the maximum clinical dose of 16.67 mg·kg⁻¹ per day for a 60-kg adult, with a conversion factor of 6 to determine the equivalent rat dose[7]). The other treatment groups received a dose of 14 g·kg⁻¹. Rats were fasted for 12 hours before the experiment but allowed free access to water.

Sample Collection and Preservation

After the final temperature measurement, rats were anesthetized with sodium pentobarbital (40 mg·kg⁻¹), and blood was collected from the abdominal aorta. The blood was left to stand at room temperature for 30 minutes, then centrifuged at 3,500 r·min⁻¹ for 15 minutes at 4 °C. The supernatant serum was collected and stored at −80 °C for later use.

The hypothalamus of the rats was excised, dried with filter paper, weighed, and homogenized in precooled physiological saline at a ratio of 1:9 (m:v. “m” represents the weight of the hypothalamus; “v” represents the volume of physiological saline). The homogenate was centrifuged at 3,500 rpm·min⁻¹ for 15 minutes, and the supernatant was stored at −80 °C.

Body Temperature Change Curves in Each Group

Baseline body temperature was determined by measuring the temperature three times before modeling and taking the average. After modeling, body temperature was measured every hour. The administration began 5 hours after modeling, and monitoring continued for 10 hours. The average body temperature change curves for each group were recorded and plotted to compare the fever patterns and characteristics among different treatment groups. The temperature change amplitude (ΔT) was defined as the difference between the measured temperature at each time point and the baseline temperature.

Detection of Serum IL-1β, IL-6, Ca²⁺, and Hypothalamic, prostaglandin e2 Levels

The biochemical levels of serum IL-1β, IL-6, and hypothalamic PGE₂ were detected using ELISA, while serum Ca²⁺ levels were measured using a microplate method. All experimental steps were performed according to the kit instructions.

Determination of Trace Element Content in Raw Gypsum and Calcination of Gypsum and Corresponding Baihu Decoction Freeze-Dried Powder

RG, CG170, CG350, and the corresponding BHT freeze-dried powders were completely dissolved, and semiquantitative analysis was performed using ICP-MS. The elements analyzed were those with relatively high content in RG[8] [9]: B, Na, Mg, Al, Si, K, Ca, Ti, Cr, Mn, Fe, Ni, and Sr.

Investigation of the Complexation of Mangiferin with Inorganic Elements in Baihu Decoction

UV-Vis Spectroscopy to Predict the Complexation of Mangiferin with Inorganic Elements

Mangiferin (8.447 mg) was accurately weighed and dispersed in 20 mL of H₂O, vortexed, and mixed uniformly to prepare a 1 × 10⁻³ mol·L⁻¹ solution. Equimolar concentrations of M(Cl)_X solutions (M = Ca²⁺, Al³⁺, Zn²⁺, Na⁺, K⁺, Ni²⁺, Cu²⁺, Mg²⁺, Fe³⁺; X: the ratio of different metal ions to Cl⁻) were prepared. Different volume ratios (1:0.2, 1:0.4, 1:0.6, 1:0.8, 1:1, 1:1.2, 1:1.4, 1:1.6) of mangiferin aqueous solution and metal salt solution were vortexed and mixed, then left to stand for 4 to 5 hours. Absorbance was measured at a wavelength of 318.5 nm. Origin 9.0 software was used to process the experimental data and plot the UV absorption curves of mangiferin–metal complexes to evaluate the chelating ability of mangiferin for metal ions. The molar ratio method was used to determine the coordination ratio between mangiferin and metal ions, and the binding constant was calculated using Bindfit.

Fluorescence Spectroscopy to Predict the Complexation of Mangiferin with Inorganic Elements

A total of 3 mg of finely ground mangiferin was dispersed in 20 mL of deionized water, vortexed, and mixed uniformly for later use. It was then mixed with an equal volume of a 1.0 × 10⁻³ mol·L⁻¹ metal salt aqueous solution. The fluorescence response intensity of mangiferin to cations and the shift in the maximum emission wavelength were measured at an excitation wavelength of 403 nm to analyze possible electronic transitions and coordination effects.

Study on the In Vitro Synergistic Anti-inflammatory Effects of Inorganic Elements in Baihu Decoction

Preparation of Medicinal Solutions

RG was replaced with equivalent amounts of CaSO₄, CaSO₄ + Fe₂O₃+ Cr₂O₃+ Al₂O₃ + SiO₂, and different variable groups of BHT decoctions were prepared. These were named Ca-BHT, (Ca + Fe + Cr + Al + Si)-BHT, (Ca + Fe + Cr)-BHT, (Ca + Si)-BHT, (Ca + Al)-BHT, and (Fe + Cr + Al + Si)-BHT.

Preparation of Drug-containing Serum

After 1 week of adaptive feeding, SD rats were randomly divided into the following groups: Control, BHT, Ca-BHT, (Ca + Fe + Cr + Al + Si)-BHT, (Ca + Fe + Cr)-BHT, (Ca + Si)-BHT, (Ca + Al)-BHT, and (Fe + Cr + Al + Si)-BHT, with six rats in each group. The dosing regimen was the same as before, while the Control group received an equivalent volume of distilled water by gavage for 7 consecutive days. After fasting for 12 hours, blood was collected from the abdominal aorta 1 hour after the last administration. The blood was left to stand at room temperature or in a 37 °C water bath for 30 minutes,[10] then centrifuged at 3,000 rpm·min⁻¹ for 15 minutes at 4 °C. The serum was heat-inactivated in a 56 °C water bath for 30 minutes and sterilized by filtration through a 0.22-μm membrane.[11] [12] [13] Serum from the same group was mixed, aliquoted, and stored at −80 °C for later use.

Cell Culture

Mouse macrophage RAW264.7 cells were cultured in Dulbecco's modified eagle medium(DMEM) medium supplemented with 10% heat-inactivated fetal bovine serum and 1% penicillin/streptomycin. The cells were incubated at 37 °C in a humidified environment with 5% CO₂ and 95% air.

Screening of Drug-containing Serum Concentration Using the CCK-8 Assay

Cells in the logarithmic growth phase were seeded at 1 × 10⁴ cells/mL in a 96-well plate. After overnight incubation, different concentrations of drug-containing serum were added, with groups including Control (20% blank serum), 5%, 10%, 15%, and 20% drug-containing serum (supplemented with blank serum if necessary to reach 20%[11]). Each group had six replicates.[13] [14] After 24 hours of incubation, 10 μL of CCK-8 reagent was added, and the cells were incubated for 30 minutes. Absorbance at 450 nm was measured using a microplate reader to determine the optimal drug-containing serum concentration.

Cell Grouping and Intervention

Cells were divided into the following groups: Control, Model, BHT, Ca-BHT, (Ca + Fe + Cr + Al + Si)-BHT, (Ca + Fe + Cr)-BHT, (Ca + Si)-BHT, (Ca + Al)-BHT, and (Fe + Cr + Al + Si)-BHT. Except for the Control group, all other groups were induced with 2.5 μg·L⁻¹ IFN-γ and 200 μg·L⁻¹ LPS to create an inflammatory model in RAW264.7 cells. After 24 hours of induction, the optimal concentration of drug-containing serum or blank serum was added to the cells for another 24 hours.

Detection of Nitric Oxide Content in Cell Supernatant Using the Griess Method

Cell supernatant was collected and added to a 96-well plate (100 μL per well). Griess reagent I (0.1% ethylenediamine dihydrochloride solution) and Griess reagent II (1% sulfanilamide solution) were mixed in equal volumes, and 100 μL of the mixture was added to each well. The plate was incubated in the dark at 37 °C for 10 minutes, and absorbance was measured at 540 nm using a microplate reader.

qPCR Detection of IL-6 mRNA, TNF-α mRNA, and PGE ² mRNA, Levels in Each Group

After collecting the cells, total RNA was extracted using the Trizol method. RNA was reverse-transcribed into cDNA using a reverse transcription kit. GAPDH was used as the internal reference. The PCR instrument was programmed according to the kit instructions, with a 20-μL reaction system. The 2^−ΔΔCt method was used to calculate the expression levels of each gene. Primer sequences are listed in [Table 1].

Table 1 Primer sequences (5′–3′)

Gene name	Forward	Reverse
IL-6	CATAGCTACCTGGAGTACATGAAGAA	GACTCCAGCTTATCTCTTGGTTGA
IL-1β	GCTTCAGGCAGGCAGTATCA	AATGGGAACGTCACACACCA
TNF-α	CCGTCAGCCGATTTGCTATCT	GCAATGACTCCAAAGTAGACCTG
PGE2	GCAACATCAGCGTTATCCTCAA	TAGGCAAAGATTGTGAAAGGCA
iNOS	CTGTCGCAGCTCCCTATCTT	TCAGGTTCCTGATCCAAGTGC
GAPDH	CCTCGTCCCGTAGACAAAATG	TGAGGTCAATGAAGGGGTCGT

Abbreviations: iNOS, inducible nitric oxide synthase; PGE2, prostaglandin E2.

Statistical Analysis

Statistical analysis of the experimental data was performed using SPSS 26 software. Data are presented as mean ± standard error (x̄ ± s). Comparisons among multiple groups were conducted using one-way analysis of variance (ANOVA). P-value <0.05 was considered statistically significant.

Results

Analysis of Phase Composition of Raw Gypsum and Calcination of Gypsum

The XRD experiment allowed a comparison of the prepared samples with the raw material to determine if new phases were formed. The results are shown in [Fig. 1]. RG exhibited diffraction peaks at 2θ = 11.46, 20.54, 23.22, and 28.92 degrees, which were distinctly different from the diffraction patterns of CG. The CG samples (CG110, CG140, CG170, CG200, CG250, CG300) showed characteristic diffraction peaks of hemihydrate gypsum at 2θ = 14.68, 29.60, 31.80, 42.20, and around 54 and 55 degrees. These peaks were almost absent from RG and CG350, CG400, CG450, and CG750. New peaks corresponding to anhydrite (CaSO₄) appeared at 25.60, 31.36, 36.30, 38.60, 40.80, 41.30, 43.30, 52.30, and 55.70 degrees.

Fig. 1 X-ray diffraction patterns of RG and CG at different temperatures.Notes: Triangles indicate characteristic diffraction peaks of RG, diamonds indicate characteristic peaks of hemihydrate RG, and circles indicate characteristic peaks of calcium sulfate. CG, calcination of gypsum; RG, raw gypsum.

CG140 exhibited characteristic diffraction peaks of RG at 11.46 and 23.22 degrees, while CG170 lacked these peaks but showed peaks corresponding to hemihydrate gypsum and calcium sulfate. This indicates that the transition temperature for the conversion of CaSO₄·2H₂O to CaSO₄·0.5H₂O and CaSO₄ lies between 140 °C and 170 °C. CG400 showed almost no characteristic peaks of hemihydrate gypsum, while CG350 exhibited peaks of hemihydrate gypsum at 14.68, 29.68, and 31.84 degrees, along with peaks of CaSO₄ at 31.36, 36.30, 38.60, 40.80, 43.30, 52.30, and 55.70 degrees. This suggests that the transition temperature for the conversion of CaSO₄·0.5H₂O to CaSO₄ lies between 350 °C and 400 °C. Therefore, it is hypothesized that the change in efficacy of RG before and after calcination may be related to the loss of crystalline water from CaSO₄·2H₂O, leading to changes in spatial configuration.

Analysis of Phase Composition of Calcination of Gypsum at Specific Temperatures before and after Water Addition

Based on the results above, CG at 170 °C and 350 °C represent the critical temperatures for the conversion of CaSO₄·2H₂O to CaSO₄·0.5H₂O and CaSO₄·0.5H₂O to CaSO₄, respectively. RG calcined at 750 °C showed no characteristic peaks of dihydrate or hemihydrate gypsum. These temperatures were selected to investigate whether the CG could revert to RG upon water addition. As shown in [Fig. 2], CG170 and CG350 exhibited characteristic peaks of dihydrate gypsum after water addition, while the peaks of calcium sulfate disappeared. This indicates that the crystalline state of CG170 and CG350 can be restored. In contrast, CG750 showed no change in its characteristic peaks after water addition, indicating that this crystalline transformation is irreversible.

Fig. 2 X-ray diffraction patterns of CG at specific temperatures before and after water addition. CG, calcination of gypsum.

Effects of Raw Gypsum in Different Crystalline States on the Antipyretic Effect of Baihu Decoction

Body Temperature Change Curves in Each Group

After establishing the dry yeast-induced fever model, the body temperature of rats in all groups significantly increased (p < 0.05) compared with the Control group at 4 hours postmodeling, indicating the successful establishment of the fever model. see [Table 2]. After drug intervention, compared with the Model group, the Positive group showed significant antipyretic effects 1 hour after administration, with extremely significant differences (P < 0.01) from 1 to 4 hours and a significant difference (P < 0.05) at 5 hours. The BHT group showed extremely significant differences (P < 0.01) at 1, 3, and 4 hours and significant differences (P < 0.05) at 2 and 5 hours. The CG170-BHT group showed an extremely significant difference (P < 0.01) at 2 hours. The (CG170 + H₂O)-BHT group showed significant differences (P < 0.05) at 2 and 4 hours, with a more significant cooling trend at 4 hours compared with the BHT group. The CG350-BHT and (CG350 + H₂O)-BHT groups showed no antipyretic effects (P > 0.05). See [Table 3].

Table 2 Changes in body temperature of dry yeast-induced fever model rats (x̄ ± s)

Groups	n	Temperature before modeling/°C	Temporal changes in animal body temperature after modeling ΔT/°C
			1 h	2 h	3 h	4 h	5 h
Control	6	36.75 ± 0.29	0.28 ± 0.41	0.17 ± 0.21	−0.05 ± 0.21	0.00 ± 0.33	−0.10 ± 0.30
Model	6	37.02 ± 0.22	−0.12 ± 0.21	−0.15 ± 0.22	0.00 ± 0.18	0.63 ± 0.43#	1.57 ± 0.41##
Positive	6	36.95 ± 0.16	−0.38 ± 0.25	−0.62 ± 0.41	−0.25 ± 0.45	0.72 ± 0.32##	1.57 ± 0.44##
BHT	6	37.55 ± 0.41	−0.38 ± 0.46	−0.58 ± 0.31	0.07 ± 0.43	0.68 ± 0.69	1.60 ± 0.64##
CG170-BHT	6	37.25 ± 0.53	0.05 ± 0.36	−0.43 ± 0.51	−0.08 ± 0.54	0.48 ± 0.42	1.63 ± 0.63##
(CG170 + H2O)-BHT	6	37.12 ± 0.30	0.07 ± 0.48	−0.27 ± 0.37	−0.08 ± 0.48	0.83 ± 0.62#	1.60 ± 0.53##
CG350-BHT	6	36.70 ± 0.61	−0.12 ± 0.41	−0.15 ± 0.62	0.02 ± 0.53	0.87 ± 0.49##	1.62 ± 0.85##
(CG350 + H2O)-BHT	6	36.88 ± 0.44	−0.02 ± 0.44	−0.08 ± 0.27	0.15 ± 0.44	0.82 ± 0.45##	1.58 ± 0.63##

Abbreviation: BHT, Baihu Decoction.

Notes: Compared with the control group, ^# P<0.05, ^## P<0.05.

Table 3 Effects of Baihu Decoction with raw gypsum in different crystalline states on body temperature in dry yeast-induced fever model rats after drug administration (x̄ ± s)

Groups	n	Temporal changes in animal body temperature after administration ΔT/°C
		1 h	2 h	3 h	4 h	5 h
Control	6	−0.15 ± 0.30	−0.23 ± 0.28	−0.22 ± 0.45	−0.17 ± 0.21	−0.12 ± 0.13
Model	6	2.37 ± 0.25	2.33 ± 0.33	2.30 ± 0.43	2.32 ± 0.40	2.18 ± 0.49
Positive	6	0.75 ± 0.54*	0.73 ± 0.73*	1.03 ± 0.81*	1.17 ± 0.58*	1.15 ± 0.78**
BHT	6	1.63 ± 0.37*	1.73 ± 0.45**	1.42 ± 0.45*	1.38 ± 0.4*	1.28 ± 0.56**
CG170-BHT	6	2.05 ± 0.27	1.68 ± 0.34*	1.82 ± 0.43	2.00 ± 0.57	1.87 ± 0.43
(CG170 + H2O)-BHT	6	2.22 ± 0.35	1.83 ± 0.37**	2.08 ± 0.32	1.10 ± 0.31*	1.85 ± 0.45
CG350-BHT	6	2.50 ± 0.59	2.38 ± 0.73	2.30 ± 0.84	1.93 ± 0.86	2.35 ± 0.50
(CG350 + H2O)-BHT	6	2.48 ± 0.60	2.08 ± 0.50	2.17 ± 0.58	2.27 ± 0.61	2.08 ± 0.82

Abbreviation: BHT, Baihu Decoction.

Notes: Compared with the model group, *P<0.05, **P<0.05.

Effects of Baihu Decoction with Raw Gypsum in Different Crystalline States on Pyrogenic Factors in Fever Model Rats

As shown in [Fig. 3], compared with the Control group, the levels of IL-1β, IL-6, Ca²⁺ in serum, and PGE₂ in the hypothalamus were significantly increased (P < 0.01) in the Model group. Compared with the Model group, the Positive group showed significantly reduced levels of IL-1β, IL-6, Ca²⁺, and PGE₂ (P < 0.01). The BHT, CG170-BHT, (CG170 + H₂O)-BHT, and (CG350 + H₂O)-BHT groups showed significantly reduced serum IL-6 levels (P < 0.05). The BHT and (CG170 + H₂O)-BHT groups showed significantly reduced serum IL-1β levels (P < 0.05). The BHT and CG170-BHT groups showed significantly reduced PGE₂ levels in the hypothalamus (P < 0.05). It can be inferred that BHT primarily exerts its antipyretic effect by reducing the levels of IL-1β and IL-6 in serum, thereby decreasing the concentration of PGE₂ in the hypothalamus. Additionally, it was found that serum Ca²⁺ decreased to varying degrees, suggesting that the antipyretic effect of RG is not solely related to Ca²⁺, and other inorganic elements may have synergistic effects.

Fig. 3 Effects of Baihu Decoction with RG in different crystalline states on pyrogenic factors in fever model rats.Notes: Compared with the control group, ^## p < 0.01; compared with the model group, *p < 0.05, **p < 0.01; compared with the BHT group, ⁺ p < 0.05, ⁺⁺ P<0.01. BHT, Baihu Decoction; PGE₂, prostaglandin E2; RG, raw gypsum.

Comparison of Trace Element Content in Raw Gypsum and Calcination of Gypsum and Corresponding Baihu Decoction Freeze-Dried Powder

As shown in [Table 4], after calcination, the content of most elements decreased except for Ca, Fe, Ti, and Sr, which increased, and B, which showed irregular changes. The main components of RG, CG170, and CG350 were Ca and Si, and the measured inorganic elements followed a similar trend in content: Ca > Si > Mg > K (or Na) > Fe > Ti > Sr (or Al) > B (or Cr) > Ni > Mn. Ca, as the most abundant element, showed higher content with increasing calcination temperature, likely due to the loss of crystalline water and denser crystalline structure after calcination, leading to a relative increase in its content. Compared with RG, the content of Ca, Sr, Al, and Na in CG varied significantly, suggesting that the differences in properties and efficacy of RG before and after calcination may be related to changes in inorganic element content.

Table 4 Comparison of inorganic element content in raw gypsum and calcination of gypsum at specific temperatures

Sample element content/µg·g−1	RG	CG170	CG350
B	114.42	21.24	130.41
Na	1,127.13	719.56	786.54
Mg	2,922.53	2,312.81	2,415.21
Al	331.27	102.45	147.74
Si	3,261.90	3 260.50	2,905.90
K	939.76	739.80	805.54
Ca	34,345.41	43,193.54	45,410.53
Ti	438.88	459.90	486.08
Cr	42.35	29.85	34.84
Mn	5.81	4.67	5.63
Fe	460.33	474.02	599.31
Ni	14.85	11.48	12.11
Sr	199.97	236.33	242.63

Abbreviations: CG, calcination of gypsum; RG, raw gypsum.

As shown in [Table 5], the content of most inorganic elements decreased after incorporation into the formula, primarily due to the low solubility of mineral drugs and the adsorption of some elements by the residue during filtration.[15] The trends in element content before and after incorporation into the formula were mostly different, possibly because the other three herbs in the formula also contain trace elements and changes in the pH of the decoction during boiling may affect the dissolution of inorganic elements or their interaction with organic molecules and polysaccharides in the herbal drugs.[16] [17]

Table 5 Comparison of inorganic element content per unit of raw herb in freeze-dried powder of each decoction group

Sample element content/µg·g−1	BHT	CG170-BHT	CG350-BHT
B	50.46	38.67	17.16
Na	20.27	15.28	3.95
Mg	156.07	149.06	11.42
Al	34.56	149.06	11.42
Si	865.01	410.73	240.52
K	428.50	437.80	7.10
Ca	34,935.23	15,788.06	5,030.97
Ti	19.76	6.74	73.88
Cr	0.79	1.98	0.55
Mn	1.56	1.60	0.16
Fe	24.47	23.73	7.15
Ni	1.07	0.75	0.42
Sr	30.84	7.48	1.47

Abbreviations: BHT, Baihu Decoction; CG, calcination of gypsum; RG, raw gypsum.

Among the three formulas, Ca was the most abundant element, and its content decreased with higher calcination temperatures. This is because CG loses crystalline water, resulting in a denser structure that makes Ca²⁺ less soluble. Compared with BHT, the content of Ca, Sr, Si, and Na in the CG formulas decreased significantly after incorporation into the formula. In CG170-BHT, the content of Al, Cr, Mn, and K increased, while in CG350-BHT, only Ti content increased. These elements may influence the efficacy of RG. Previous studies[18] [19] have shown that the Na⁺/Ca²⁺ ratio affects the antipyretic efficacy of BHT. The Na⁺/Ca²⁺ ratios in BHT, CG170-BHT, and CG350-BHT were 0.00058, 0.00097, and 0.00078, respectively, with BHT having the lowest ratio, which suggests superior antipyretic efficacy.

Analysis of the Chelation Ability of Mangiferin with Inorganic Elements in Baihu Decoction

The complexation of mangiferin with different metal salts M(Cl)_X was measured using UV-Vis spectroscopy, and the binding constants were calculated using Bindfit. Some experimental results are shown in [Fig. 4]. The results indicate that the combined metering ratios of mangiferin with Cu²⁺ and Al³⁺ were 1:1 and 1:2, with binding constants (Ka) of 1.00 × 10² mol·L⁻¹ and 7.41 × 10⁶ mol·L⁻¹, respectively. This suggests that mangiferin has a stronger binding affinity for Al³⁺, which is consistent with the fluorescence response patterns.

Fig. 4 Analysis of the chelation ability of mangiferin with Cu²⁺ (A) and Al³⁺ (B) at different molar ratios.

The fluorescence response experiment of mangiferin to different metal salts M(Cl)_X showed that the addition of different metal salt solutions had varying effects on the fluorescence intensity of mangiferin, as illustrated in [Fig. 5]. The addition of certain metal salts caused fluorescence quenching, particularly with Cu²⁺ and Fe³⁺, while other metal salts resulted in varying degrees of fluorescence enhancement, most notably with Al³⁺ and Zn²⁺, which increased fluorescence intensity by 120-fold and 30-fold, respectively. The maximum emission wavelength also exhibited varying degrees of blue shift, with Al³⁺ being the most typical. These results suggest that there may be electron transitions and coordination interactions between mangiferin and the aforementioned metals.

Fig. 5 Fluorescence response of mangiferin to different metals (A) and color change diagram (B).

Study on the in Vitro Synergistic Anti-inflammatory Effects of Inorganic Elements in Baihu Decoction

Effects of Different Concentrations of Drug-containing Serum on Cell Viability

Compared with the Control group, some drug-containing serum groups at 5%, 10%, and 20% concentrations showed significant differences (p < 0.01) in the viability of RAW264.7 cells, while the 15% drug-containing serum group showed no statistically significant difference (p > 0.05). Therefore, the 15% drug-containing serum was selected for subsequent in vitro efficacy experiments. See [Fig. 6].

Fig. 6 Effects of different concentrations of drug-containing serum on cell viability. (A) effects of 5% drug-containing serum on cell viability. (B) effects of 10% drug-containing serum on cell viability. (C) effects of 15% drug-containing serum on cell viability. (D) effects of 20% drug-containing serum on cell viability. Compared with the control group, ^# p < 0.05, ^## p < 0.01.

Comparison of Nitric Oxide Expression Levels in Cell Supernatant among Different Treatment Groups

As shown in [Fig. 7], compared with the Control group, the level of NO in the supernatant of RAW264.7 cells induced by LPS and IFN-γ significantly increased (p < 0.01). Compared with the Model group, all treatment groups except Ca-BHT and (Fe + Cr + Al + Si)-BHT significantly reduced the level of NO in the cell supernatant (p < 0.05), with BHT and (Ca + Al)-BHT showing the highest reduction (p < 0.01). This suggests that all groups have some anti-inflammatory effects, and calcium and aluminum may have synergistic anti-inflammatory effects.

Fig. 7 Comparison of NO expression levels in cell supernatant among different treatment groups.Notes: Compared with the control group, ^## p < 0.01; compared with the model group, *p < 0.05, **p < 0.01. BHT, Baihu Decoction; NO, nitric oxide.

Comparison of Inflammatory Factor Expression Levels in Cells among Different Treatment Groups

As shown in [Fig. 8], compared with the Control group, the expression levels of IL-6 mRNA, TNF-α mRNA, and PGE₂ mRNA in the Model group were significantly increased (p < 0.01). Compared with the Model group, all treatment groups showed some reduction in the expression levels of IL-6 mRNA and PGE₂ mRNA, while no significant effect was observed on TNF-α mRNA expression. This indicates that the treatment groups may exert anti-inflammatory effects by influencing the expression levels of IL-6 mRNA and PGE₂ mRNA. Among them, the (Ca + Al)-BHT group significantly reduced the expression levels of IL-6 mRNA and PGE₂ mRNA (p < 0.01). Additionally, the (Ca + Si)-BHT and (Ca + Fe + Cr + Al + Si)-BHT groups also showed a trend of reducing IL-6 mRNA expression and significantly reduced PGE₂ mRNA levels (p < 0.01). This suggests that Ca, Fe, Cr, Al, and Si may have synergistic anti-inflammatory effects, with calcium sulfate and aluminum oxide showing superior in vitro synergistic anti-inflammatory effects compared with other treatment groups.

Fig. 8 Comparison of inflammatory factor expression levels in cells among different treatment groups. (A) effects of different treatment groups on IL-6 mRNA expression in cells. (B) effects of different treatment groups on TNF-α mRNA expression in cells. (C) effects of different treatment groups on PGE₂ mRNA expression in cells. Compared with the Control group, ^## p < 0.01; compared with the Model group, *p < 0.05, **p < 0.01. BHT, Baihu Decoction; PGE2, prostaglandin E2.

Discussions

This study first investigated the changes in the phase structure of RG and RG calcined at different temperatures using XRD. It confirmed that 170 °C and 350 °C are the transition temperatures for crystalline state changes. When the calcination temperature reached 750 °C, the XRD results indicated that RG had completely transformed into CaSO₄. By grinding CG170, CG350, and CG750 with water, it was found that CG170 and CG350 could revert to the crystalline state of RG, while CG750 could not, suggesting that the crystalline state changes between RG and CG are reversible under certain conditions.

Using ICP-MS, the content of inorganic elements in each sample was measured. The results showed that, compared with RG, the elements with significant changes in CG were Ca, Sr, Al, and Na, with B, showing unique variations in RG calcined at different temperatures. After incorporating CG and RG into the formula, the elements with significant changes were Ca, Sr, Si, and Na. Pharmacodynamic studies in animal experiments revealed that (CG170 + H₂O)-BHT exhibited antipyretic effects, indicating that the antipyretic function could be restored when the crystalline state of CG170 was reverted by adding water. Although the crystalline state of CG350 could be restored by adding water, its antipyretic effect was not restored, suggesting that the antipyretic material basis of RG is not significantly influenced by its crystalline state but may be related to other trace elements. CG170-BHT showed antipyretic effects, while CG350-BHT had almost none. Notably, the content of Al, Cr, Mn, and K in CG170-BHT and Ti in CG350-BHT showed unique variations. Studies have shown[20] [21] [22] that Sr can reduce the expression of inflammatory factors such as IL-6 and IL-8 by modulating the endothelial nitric oxide synthase (eNOS)/nitric oxide (NO) pathway or by lowering the Na⁺/Ca²⁺ ratio, thereby exerting antipyretic effects. It has also been confirmed[23] [24] that oral TiO₂ exacerbates the severity of colitis in mice, and Mn exhibits neurotoxicity without anti-inflammatory effects, thus ruling out their involvement. Additionally, research has demonstrated[25] that the hydration capacity of CG follows the order: CG150 > CG350 > CG750, with hydration capacity being one of the indicators for the dampness-removing and sore-healing effects of CG. Elements such as B, Si, Cr, and K also exhibit anti-inflammatory or immunomodulatory effects.[26] [27] [28] [29] For instance, sodium metasilicate significantly reduces the expression of TNF-α and inducible nitric oxide synthase (iNOS) mRNA in LPS-induced inflammatory cells. Chromium can activate adenosine monophosphate-activated protein kinase (AMPK), and lead to the deacetylation of NF-κB and the inhibition of NF-κB signaling and the expression of inflammatory cytokines. In summary, the differences in the content of B, Si, Cr, and K may also influence the efficacy of RG calcined at different temperatures, with Ca, Sr, and Na being the most critical elements.

Studies have shown[30] [31] that mangiferin and glycyrrhizic acid are bioactive compounds in Baihu Guizhi Decoction that exert antirheumatoid arthritis effects by downregulating thermogenesis-related proteins in the protein kinase A(PKA)-adenylate cyclase 5(ADCY5)-peroxisome proliferator activated receptor gamma (PPARγ)-PPAR-γ coactivator-1 alpha(PGC1α)-uncoupling protein 1(UCP1) -PR domain containing 16(PRDM16) signaling axis. Other studies[4] suggest that the nanophase in BHT exhibits the best antipyretic effect, hypothesizing that glycyrrhizic acid and its derivatives, which have solubilizing effects, can enhance the solubility of mangiferin and neomangiferin. Additionally, inorganic ions such as Ca²⁺, Mg²⁺, and Zn²⁺ in RG act as zeta potential modifiers, which form an electric double layer that stabilizes the nanophase. Combined with the results of UV and fluorescence experiments, it is evident that among the inorganic elements, Al, Cu, Fe, and Zn are most likely to form coordination compounds with mangiferin, thereby influencing the dissolution of active components and antipyretic efficacy. In vitro experiments further indicate that Ca has synergistic anti-inflammatory effects with Fe, Cr, Al, and Si, suggesting that Fe and Al are the most likely elements to serve as the material basis for the efficacy of RG.

Conclusion

The inorganic elements Ca, Sr, Na, Fe, and Al in RG are most likely the key material basis for its pharmacological effects, with other elements potentially contributing synergistically. However, there is limited reporting on the effects, dose–response relationships, modes of action, and mechanisms of these inorganic elements in RG, which warrants further research and exploration. TCM decoctions are complex aqueous equilibrium systems where various inorganic elements and chemical forms coexist.[32] Moreover, the metabolic process of drugs in the body are intricate, and ICP-MS can only detect the total content of inorganic elements in samples, not their compound states. Therefore, future studies should incorporate methods such as X-ray photoelectron spectroscopy and metabolomics to further investigate these aspects.

Conflict of Interest

The authors declare no conflict of interest.

CRediT Authorship Contribution Statement

Yunyun Wang: Project administration and validation. Zhengxian Zhang: Conceptualization, data curation and writing—original draft. Haotian Peng: Data curation, methodological and writing—review and editing. Huahui Zeng: Data curation and software. Xiangxiang Wu: Methodology and writing—review and editing.

• References

• 1 National Pharmacopoeia Committee. Pharmacopoeia of the People's Republic of China. China Medical Science Press; 2020
• 2 Li Q, Li SS, Zhang H. Research on processing mechanism of water grinding on Realgar. Chin Tradit Herbal Drugs 2023; 54 (23) 7751-7758
• 3 Li Y. Effect of Calcining Temperature on Physicochemical Properties and Pharmacological Action of gypsum. Beijing: Beijing University of Chinese Medicine; 2017
• 4 Lü S, Su H, Sun S. et al. Isolation and characterization of nanometre aggregates from a Bai-Hu-Tang decoction and their antipyretic effect. Sci Rep 2018; 8 (01) 12209
• 5 Ping Y, Li Y, Lü S. et al. A study of nanometre aggregates formation mechanism and antipyretic effect in Bai-Hu-Tang, an ancient Chinese herbal decoction. Biomed Pharmacother 2020; 124: 109826
• 6 Guo Z. Separation and Characterization of Gegen-qin-lian Decoction. Fuzhou: Fuzhou University; 2014
• 7 Zhang F, Wang D, Li X, Li Z, Chao J, Qin X. Metabolomic study of the fever model induced by baker's yeast and the antipyretic effects of aspirin in rats using nuclear magnetic resonance and gas chromatography-mass spectrometry. J Pharm Biomed Anal 2013; 81-82: 168-177
• 8 Tian TY, Bao YR, Meng XS. Analysis of inorganic elements in gypsum fibrosum from different origins based on ICP-MS. Zhonghua Zhongyiyao Xuekan 2017; 35 (04) 1041-1043
• 9 Wang W, Zhou CX, Zhang YS. Comparative analysis of trace elements in gypsum from different regions. Chin Pharm 2014; 17 (06) 972-974
• 10 Tang J, Zhang Q, Wu D. et al. Potential pharmacodynamic substances of Laportea bulbifera in treatment of rheumatoid arthritis based on serum pharmacochemistry and pharmacology [in Chinese]. Zhongguo Zhongyao Zazhi 2022; 47 (17) 4755-4764
• 11 Wang F, Xiao M, Chen BC. The drug-containing serum of Suoquan Yishen Formula regulates the epithelial-mesenchymal transformation of glomerular podocytes by inhibiting KDM6A. Pharm Clin Chin Mater Med 2024; 40 (05) 8-14
• 12 Xie F, Jian GH, Dai BY. Investigation of the effect of drug-containing serum of Huoxi Decoction on chondrocyte pyroptosis based on CCL2/CCR2/NF-κB pathway. Pharm Clin Chin Mater Med 2024; 40 (05) 30-36
• 13 Qin MY, Huang SQ, Zou XQ. et al. Drug-containing serum of rhubarb-astragalus capsule inhibits the epithelial-mesenchymal transformation of HK-2 by downregulating TGF-β1/p38MAPK/Smad2/3 pathway. J Ethnopharmacol 2021; 280: 114414
• 14 Pan J, Jiang Y, Huang Y. et al. Liuwei Dihuang decoction drug-containing serum attenuates transforming growth factor-β1-induced epithelial-mesenchymal transition in HK-2 cells by inhibiting NF-κB/snail signaling pathway. Curr Pharm Biotechnol 2023; 24 (12) 1589-1602
• 15 Li CL. Standardized Study of Baihu Decoction. Nanjing: Nanjing University of Chinese Medicine; 2012
• 16 Tian HX. Effect of Polished Round-grained Rice on Composition and Function of Baihu decoction. Beijing: Beijing University of Chinese Medicine; 2022
• 17 Lin N. Effects of Different pH on Biological Activities and Colloidal Properties of Radix Isatidis Decoction (Banlangen). Fuzhou: Fuzhou University; 2011
• 18 Zhang Y, Li CJ. The effects of perfusion of lateral ventricle with CaCl2 on the febrile response and cAMP content in plasma and cerebrospinal fluid during LP-induced fever. Sci China B Chem Life Sci Earth Sci 1991; 34 (03) 317-326
• 19 Feldberg W, Myers RD, Veale WL. Perfusion from cerebral ventricle to cisterna magna in the unanaesthetized cat. Effect of calcium on body temperature. J Physiol 1970; 207 (02) 403-416
• 20 Song C, Zhang ZJ, Bian BL. Hypothesis on material basis of medicinal gypsum cooling. Guangpuxue Yu Guangpu Fenxi 2020; 40 (06) 1716-1721
• 21 Lin Y, Xin Z, Xia Y, Wen X, Xin F, Ruan G. Effect of strontium in drinking water on blood pressure and inflammatory function in hypertension mice [in Chinese]. Wei Sheng Yan Jiu 2023; 52 (04) 598-603
• 22 Buache E, Velard F, Bauden E. et al. Effect of strontium-substituted biphasic calcium phosphate on inflammatory mediators production by human monocytes. Acta Biomater 2012; 8 (08) 3113-3119
• 23 Duan S, Wang H, Gao Y, Wang X, Lyu L, Wang Y. Oral intake of titanium dioxide nanoparticles affect the course and prognosis of ulcerative colitis in mice: involvement of the ROS-TXNIP-NLRP3 inflammasome pathway. Part Fibre Toxicol 2023; 20 (01) 24
• 24 Zhang P, Lokuta KM, Turner DE, Liu B. Synergistic dopaminergic neurotoxicity of manganese and lipopolysaccharide: differential involvement of microglia and astroglia. J Neurochem 2010; 112 (02) 434-443
• 25 Liu CY, Han S, Tang YN. The hydration process of gypsum and its calcined products analyzed by low field nuclear magnetic resonance. J Beijing Tradit Chin Med 2021; 40 (10) 1157-1160
• 26 Farrin N, Rezazadeh L, Pourmoradian S. et al. Boron compound administration; A novel agent in weight management: A systematic review and meta- analysis of animal studies. J Trace Elem Med Biol 2022; 72: 126969
• 27 Kim EJ, Bu SY, Sung MK, Kang MH, Choi MK. Analysis of antioxidant and anti-inflammatory activity of silicon in murine macrophages. Biol Trace Elem Res 2013; 156 (1-3): 329-337
• 28 Moradi F, Maleki V, Saleh-Ghadimi S, Kooshki F, Pourghassem Gargari B. Potential roles of chromium on inflammatory biomarkers in diabetes: A systematic. Clin Exp Pharmacol Physiol 2019; 46 (11) 975-983
• 29 Tanhehco EJ. Potassium channel modulators as anti-inflammatory agents. Expert Opin Ther Pat 2001; 11 (07) 1137-1145
• 30 Mao X, Yan X, Li C, Liu Y, Zhang Y, Lin N. Extensive preclinical evaluation of combined mangiferin and glycyrrhizic acid for restricting synovial neovascularization in rheumatoid arthritis. Chin Med 2023; 18 (01) 156
• 31 Mao X, Liu Y, Li W. et al. A promising drug combination of mangiferin and glycyrrhizic acid ameliorates disease severity of rheumatoid arthritis by reversing the disturbance of thermogenesis and energy metabolism. Phytomedicine 2022; 104: 154216
• 32 Yang XD, Li GW, Wu WP. Effects of Anemarrhenae Rhizoma on the dissolution of 6 inorganic elements in gypsum fibrosum under different compatibility ratio based ongrey correlation analysis and TOPSIS model. Chin Pharm 2023; 26 (11) 346-354

Publication History

Received: 01 November 2024

Accepted: 10 January 2025

Article published online:
08 April 2025