Polymorphie DNA repair genes XRCC1 and XRCC3 and the risk for cervical cancer in Brazilian patients

ABSTRACT

Background: DNA repair genes play a key role in maintaining genomic stability and integrity. DNA repair gene polymorphisms, such as X-ray repair cross-complementing group 1 and 3 genes (XRCC1 and XRCC3), are implicated to contribute to carcinogenesis.

Objective: In this study, we investigated the correlation between cervical cancer risk and XRCC1 (Arg-l94Trp and Arg399Gln) and XRCC3 (Thr24IMet) genetic variants.

Methods: A case-control study of 77 cases of cervical cancer (including 70 carcinoma and 7 adenocarcinoma) and 73 normal women was performed. Three single nucleotide polymorphisms (SNPs) (XRCC1, and XRCC3) were genotyped by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP).

Results: Genotype frequencies of were similar between cases and controls: (XRCC1 - Arg194Trp [C-T]): CC 60(77.9%), CT 16(20.8%) e TT 1(1.3%) in cases and CC 57(78,1%), CT 16(21,9%) e TT 0(0%) in controls (p=1.00); (XRCC1 - Arg399Gln [G-A]): GG 13(16.9%), GA 28(36.4%) e AA 36(46.8%) in cases and GG 10(13,7%), GA 47(64,4%), AA 16(21,9%) in controls (p=0.01); (XRCC3 - Thr241Met [C-T]): CC 43(55,8%), CT 28(36,4%), TT 6(7,8%) in cases and CC 36(48,6%), CT 30(41,7%), TT 7(9,7%) in controls, (p=0.74). We found association XRCC1(Arg399Gln) and the risk for cervical cancer as a protective factor [OR = 0.20; IC=0.05-0.73, p=0.02] and found no association between XRCC1 (Arg194Trp) and XRCC3 (Thr241Met) polymorphisms and the risk of cervical cancer in our study.

Conclusion: Our results showed that there was positive correlation between the genetic variation Arg399Gln in XRCC1 gene and the susceptibility to cervical carcinoma in the studied population.

 

MissingLinkText

RESUMO

Introdução: Genes de reparo do DNA desempenham papel fundamental na manutenção da estabilidade e integridade genômicas. Polimorfismos em genes de reparo de DNA da família de genes X-ray repair cross-complementing grupos 1 e 3 (XRCC1 e XRCC3), são implicados no processo de carcinogênese.

Objetivo: Neste estudo, investigamos a correlação entre o risco para o surgimento de câncer cervical e a prevalência das variantes genéticas XRCC1 (Argl94Trp e Arg399Gln) e XRCC3 (Thr24IMet).

Métodos: Foi realizado um estudo caso-controle de 77 casos de câncer cervical (incluindo 70 carcinomas e 7 adenocarcinomas) e 73 mulheres saudáveis. Três polimorfismos de nucleotídeo único (SNPs) (XRCC1 e XRCC3) foram estudados pela técnica de polimerização em cadeia da polimerase com análise do polimorfismo do comprimento do fragmento de restrição (PCR-RFLP).

Resultados: As frequências dos genótipos foram semelhantes entre os casos e controles: CC (77,9%), CT 16 (20,8%) e TT 1 (1,3%) nos casos e CC 57 (78,1 %), CT 16 (21,9%) e TT 0 (0%) nos controles (p = 1,00); (36,8%) e AA 36 (46,8%) nos casos e GG 10 (13,7%), GA 47 (64,4%) e GG 13 (16,9% AA 16 (21,9%) nos controles (p = 0,01); (XRCC3 - Thr241Met [CT]): CC 43 (55,8%), CT 28 (36,4%), TT 6 (7,8%) nos casos e CC 36 (48,6%), CT 30 41,7%), TT 7 (9,7%) nos controles, (p = 0,74). A associação do genótipo XRCC1 (Arg399Gln) representa fator protetor para o desenvolvimento do câncer cervical [OR = 0,20; IC = 0,05-0,73, p = 0,02]. Não foi observada associação entre os polimorfismos XRCC1 (Arg194Trp) e XRCC3 (Thr241Met) e o risco para desenvolvimento do câncer cervical em nosso estudo.

Conclusão: Os resultados mostraram que houve correlação positiva entre a prevalência da variação genética Arg399Gln presente no gene XRCC1 e a menor suscetibilidade para o desenvolvimento de carcinoma cervical na população estudada.

 

MissingLinkText

Keywords:

XRCC1 - XRCC3 - Polymorphism, genetic - Papillomaviridae - Uterine cervical neoplasms

Descritores:

XRCC1 - XRCC3 - Polymorphism genético - Papillomaviridae - Neoplasias do colo do útero

INTRODUCTION

Cervical cancer is one of the most frequent cancers in women. It is well established that the human papillomavirus (HPV) is imputed as a prime etiologic factor of cervical carcinoma and its precursor lesion, cervical intraepithelial neoplasia (CIN). Around 30% of women with sexual experience are infected with high-risk HPV. However, only 1% of these women will develop CIN and cervical carcinoma. This indicates that HPV infection is not sufficient to develop CIN or cancer, and other cofactors, such as polymorphisms in DNA repair genes, should be considered.[1]

DNA repair genes play a key role in maintaining genomic stability and integrity. It is now thought that an individual’s DNA repair capacity is genetically determined, and is the result of a combination of multiple genes that display subtle differences in their activity. Single nucleotide polymorphisms (SNPs) may cause subtle structural alterations in repair enzymes, and subsequent modulation of cancer susceptibility. In humans, more than 100 genes are involved in the 5 major DNA repair pathways, including nucleotide excision repair (NER) and homologous recombinational repair.[2]

A number of SNPs in DNA repair genes have been identified. Defects in DNA repair pathways are found to be associated with many types of cancer, including cervical carcinoma.[3] Polymorphisms in DNA repair genes are common. Studies have revealed that the effects of these polymorphisms on DNA repair ability contribute to individual differences.[3] There are two important genes involved in this process. One, the X-Ray Repair Cross Complementing 1 (XRCC1) gene involved in the Base Excision Repair (BER) pathway, is linked with a scaffolding protein that directly associates with other proteins, such as DNA polymerase ß , PARP (ADP-ribose polymerase) and DNA ligase III, in a complex that facilitates processes of BER DNA repair[4] The other, XRCC3, one of the key components of the homologous repair (HR) pathway, functions in the cross-link repair of DNA double-strand breaks (DSBs) by interacting and stabilizing Rad51.^(5,6) It is common knowledge that chromosome damage results from non- or misrepaired DSBs, with many polymorphisms, such as those of DNA repair genes, having been associated with increased cancer risk, and a possibly even higher level of chromosome damage.⁽⁷⁾Thus, our hereby was to investigate the relationship between XRCC1 and XRCC3 polymorphisms and chromosomal damage in women with cervical cancer and healthy controls. We genotyped 3 variants of the 2 DNA repair genes XRCC1 (Arg194Trp and Arg399Gln) and XRCC3 (Thr241Met), and assessed their contributions to cervical cancer susceptibility, and their association with other epidemiological risk factors.

 

MissingLinkText

METHODS

Experimental subjects (Patients)

Patients with histologically confirmed primary cervical cancer were recruited from the city of Campo Grande, Mato Grosso do Sul State (Southwestern Brazil) from June 2014 to November 2015 at the Alfredo Abrão Cancer Hospital. The study was performed in collaboration with the Molecular Gynecology and Metabolomics Laboratory at the College of Medicine of the Federal University of São Paulo (EPM-UNIFESP), in São Paulo. Controls were randomly selected from healthy postmenopausal women who requested gynecological examinations. The criteria for selection included no positive findings during examination, no history of cancer. Sexual and reproductive history was obtained using a standardized questionnaire. A total of 77 eligible patients (70 carcinoma and 7 adenocarcinoma patients) and 73 eligible control women were interviewed, completed the questionnaires, consented to provide blood samples for genotyping. Experiments were undertaken with the understanding and written consent of each subject, and that the study conforms with The Code of Ethics of the World Medical Association (Declaration of Helsinki) and the study protocol was approved by the Federal University of São Paulo’s Institutional Review Board [IRB no. CEP1367/06] and each participant signed an informed consent.

 

MissingLinkText

Genotyping

Genomic DNA was extracted and purified using the Illustra® blood genomicPrep Mini Spin Kit (G&E HealthCare, Little Chalfont, UK) from peripheral blood lymphocytes. The polymorphisms of the 3 SNPs were detected using amplification polymerase chain reaction with restriction fragment length polymorphism (primers showed in[table 1]).[8]-[10]

Table 1 Primer sets for the amplification of XRCC1 and XRCC3 polymorphisms by polymerase chain reaction and RFLP enzymes

Gene	Primer sequences	RFLP enzyme	PCR product length (bp)	Annealing Temp (°C)
XRCC1(Arg194Trp)	5’- GCCCCGTCCCAGGTA -3’	PvuII	490	62
	5’- AGCCCCAAGACCCTTTCACT -3’
XRCC1(Arg399Gln)	5’- TCTCCCTTGGTCTCCAACCT -3’	MspI	402	60
	5’- AGTAGTCT GCTGGCTCTGG -3’
XRCC3(Thr241Met)	5’- GGTCGAGTGACAGTCCAAAC -3’	NlaIII	315	60
	5’- TGCAACGGC TGAGGGTCTT -3’

Primer sequences, endonucleases, and PCR product length.

 

MissingLinkText

Statistical analysis

Genotype and allele frequencies between the cases and controls were evaluated by the Chi square test. Univariate and multivariate logistic regression was applied to calculate odds ratios (ORs) and 95% confidence intervals (CIs), respectively, for the association between the genotypes and risk of cervical carcinoma. The association between the frequencies of all the variant genotypes and cervical cancer risk factors was also evaluated by stratification analyses.

 

MissingLinkText

 

MissingLinkText

RESULTS

Characteristics of the population

There were no differences regarding the ethnics origin of studied population, among cases 49.1% (n=52) were caucasians and 56.8% (n=25) were non-caucasians compared to 50.9% (n=54) and 43.2% (n=19) in the control group (Chi2 = 0.75; p=0.47). Of the 77 cancer patients, 70 (90.9%) had squamous cell carcinomas, 7 (9.1%) adenocarcinomas. Of the 77 cancer patients, 8 (10.4%) were IA stage, 3 (3.9%) were IIA stage, 9 (11.7%) were IIIA stage, 5 (6.5%) were IVA stage, 12 (15.6%) were IB stage, 16 (20.8%) were IIB stage, 23 (29.9%) were IIIB stage and 1 was IVB stage ([Table 2]).

Table 2 Clinical stage of cervical cancer patients

Clinical Stage	N	%
IA	8	10.4
IB	12	15.6
IIA	3	3.9
IIB	16	20.8
IIIA	9	11.7
IIIB	23	29.9
IVA	5	6.5
IVB	1	1.3
Total	77	100.0

Distribution of the study cases according to the FIGO staging of cervical cancer.

Cases of cervical intraepithelial neoplasia (CIN) were excluded from the study. The median ages of the cancer patients were 54.6 (range 20-86) years and control women were 52.3 (range 43-71) years (U = 2,532; p = 0.29). The sexual and reproductive histories including menarche, number of pregnancies, age at the first parity, number of abortions, menopause age, among cancer patients and controls were significantly different ([Table 3]).

Table 3 Quantitative variables among cases and controls

Variables		N	Mean	Std. Dev.	Median	Min.	Max.	U	P-value
Age of menarche	Cases	77	12.13	1.23	12	10	16	1,539	<0.001
	Controls	73	13.47	1.79	13	10	18
Age of menopause	Cases	56	47.46	3.01	48	40	55	1,282	<0.001
	Controls	73	49.47	3.20	50	41	55
Number of pregnancies	Cases	77	4.97	3.92	4	0	19	2,282	0.04
	Controls	73	3.48	1.67	3	1	9
Number of parities	Cases	77	4.49	3.34	4	0	17	1,982	<0.001
	Controls	73	2.89	1.44	3	0	9
Number of abortions	Cases	77	0.48	1.14	0	0	8	2,439	0.13
	Controls	73	0.60	0.94	0	0	5

Descriptive analysis of quantitative variables among cases and controls. Results obtained after Mann-Whitnney analysis

 

MissingLinkText

The genotypic and allelic frequencies

The genotype distributions and the allele frequencies of all 3 SNPs among cases and controls were not significantly different (Tables 4 and 5).

Table 4 Genotype analysis

	Wild	Heterozygote	Homozygote	Total	Exact Fisher test
	N (%)	N (%)	N (%)	N (%)
XRCC1 (Arg194Trp)
Cases	60 (77.9)	16 (20.8)	1 (1.3)	77 (100)	1.00
Controls	57 (78.1)	16 (21.9)	0 (0.0)	73 (100)
XRCC1 (Arg399Gln)
Cases	13 (16.9)	28 (36.4)	36 (46.8)	77 (100)	0.01
Controls	10 (13.7)	47 (64.4)	16 (21.9)	73 (100)
XRCC3 (Thr241Met)
Cases	43 (55.8)	28 (36.4)	6 (7,8)	77 (100)	0.74
Controls	36 (48.6)	30 (41.7)	7 (9.7)	73 (100)

Genotype distribution of polymorphisms in a case-control study. P values calculated according to the Exact Fisher Test.

Table 5 Allelic frequencies

	wild	polymorphic	total	Exact Fisher test
	N (%)	N (%)	N
XRCC1 (Arg194Trp)
Cases	136 (88.3)	18 (11.7)	154	0.86
Controls	130 (89.0)	16 (11.0)	146
XRCC1 (Arg399Gln)
Cases	54 (35.1)	100 (64.9)	154	0.06
Controls	67 (45.9)	79 (54.1)	146
XRCC3 (Thr241Met)
Cases	114 (74.0)	40 (26.0)	154	0.44
Controls	102 (69.9)	44 (30.1)	146

Allelic distribution of polymorphisms in a case-control study. P-values calculated according to the Exact Fisher Test.

 

MissingLinkText

Non-adjusted odds ratio estimation of risk for cervical cancer

Neither XRCC1 or XRCC3 (heterozygotes or mutated genotypes) influenced the risk for cervical carcinoma when using wildtype genotypes as references.

None of the variants among these 3 SNPs increased or decreased the risk for cervical cancer ([Table 6]).

Table 6 Non-adjusted Odds Ratio correlation analysis of XRCC1 and XRCC3 polymorphisms and the risk for cervical carcinoma

		Odds Ratio	95% CI	P-value
XRCC1 (Arg194Trp)
Wild	(CC)	1
Heterozygote	(CT)	0.95	0.43 - 2.08	0.90
Mutated	(TT)	NA	NA	NA
XRCC1 (Arg399Gln)
Wild	(GG)	1
Heterozygote	(GA)	0.46	0.18 - 1.18	0.11
Mutated	(AA)	1.73	0.63 - 4.77	0.29
XRCC3 (Thr241Met)
Wild	(CC)	1
Heterozygote	(CT)	1.78	1.54 - 0.48	0.48
Mutated	(TT)	0.22	2.33 - 0.58	0.58

Odds Ratio and confidence intervals (CIs.) non-adjusted for possible confusion variables.

 

MissingLinkText

Adjusted analyses of cervical cancer risk in patients with different genotypes and different risk factors

We further evaluated the association of XRCC1 and XRCC3 variant genotypes with cervical carcinoma risk stratified by high-risk exposure factors. Logistic regression analysis was performed after correction for possible confusion variables and the mutated genotype of XRCC1 (Arg399Gln) appeared to show a trend as a protective factor for the disease development when compared to wild genotype but with a weak odds ratio (OR=0.20; 95% CI = 0.05 - 0.73; p=0.02), ([Table 7]).

Table 7 Adjusted Odds Ratio analysis adjusted for age, menarche, age of menopause and number of pregnancies

		Odds Ratio	95% CI	P-value
XRCC1 (Arg194Trp)
Wild	(CC)	1
Heterozygote	(CT)	1.03	0.35 - 3.02	0.95
Mutated	(TT)	NA	NA	NA
XRCC1 (Arg399Gln)
Wild	(GG)	1
Heterozygote	(GA)	0.20	0.05 - 0.73	0.02
Mutated	(AA)	0.47	0.12 - 1.89	0.29
XRCC3 (Thr241Met)
Wild	(CC)	1
Heterozygote	(CT)	0.86	0.35 - 2.13	0.75
Mutated	(TT)	0.90	0.19 - 4.21	0.90

Odds Ratio analysis and respective confidence intervals (CIs.) adjusted for age, menarche, age of menopause and number of pregnancies.

 

MissingLinkText

 

MissingLinkText

DISCUSSION

In the present study, XRCC1 Arg399Gln heterozygote genotype were associated with a statistically significant influence on the risk for cervical carcinoma.

Several reports have explored the correlation between the XRCC1 and XRCC3 polymorphisms and risk of breast, head and neck, colorectal and thyroid cancers.[11]-[15] Some of the mentioned DNA repair genes were correlated with cervical cancer in recent study,[10] however our results did not correlate with those findings.

We found that the risk associated with XRCC1 Arg399Gln genotype was altered for cervical cancer patients, suggesting that the biological mechanism of DNA repair and may be implicated in the disease development. Moreover, cofactors associated with the development of carcinoma cells may be distinct, not only in relation to environmental risk factors but also in genetic susceptibility.^(16,17) Cervical carcinoma is known to develop from precursor CIN lesions through a multistep process.[18] However, our study could not contemplate the association between those 3 SNPs and the risk for CIN. It implied that these genes could be associated with the period of carcinogenesis from CIN to carcinoma. In summary, our findings could offer evidence of the association between polymorphisms XRCC1 gene and decreased or increased risk for cervical cancer. In addition, the effect of genotypes was less evident in those women with multiple partners, early age of sexual activity and early age of first parity.

Our results could support the hypothesis that genetic variations in the DNA repair genes may contribute to an inherited genetic susceptibility to cervical carcinoma in the studied population.

There were limitations in our study. The sample size was not enough adequate to draw definitive conclusions or perform any subgroup analyses with respect to associations between the NER genotypes and clinical stages or different histological samples (carcinoma, adenocarcinoma and CIN, for example). As with other case-control study designs, information bias is present. For example, evaluation of clinical information, were difficult to obtain from the medical record. Such cases were excluded, further limiting our sample size. Every effort was made to gather missing information, including use of the Tumor Registry and Death Index.

Despite these efforts important information such as the number of sexual partners in both groups could not be obtained. Furthermore, an element of selection bias may have been introduced in our cohort population by the fact that Alfredo Abrão Cancer Hospital is a large referral cancer center in Campo Grande city and may not be reflective of the population of typical cervical cancer patients.

However, the prevalence of the polymorphisms in these patients did not differ from that in the general population. The predictive and prognostic role of DNA repair gene polymorphisms in clinical outcomes is the subject of a growing body of literature in pharmacogenomics.^(17,18) These parameters can determine whether these polymorphisms are predictive of treatment response or prognostic by determining outcome. On the basis of the expected outcome of the patient, both factors may be important in the choice of chemotherapeutic agents.

Evaluation of genetic polymorphisms in cancer susceptibility may help us to understand the significance of these polymorphisms in the identification of individuals at higher risk of developing resistance to anticancer drug therapies. This study suggests that NER gene polymorphisms may modulate chemotherapy response and patient survival.

In the future, larger studies may provide a more complete understanding of relevant genetic factors and environmental exposures that could result in improved strategies for determining both chemotherapy choice and efficacy in clinical trials.

 

MissingLinkText

ACKNOWLEDGEMENTS

We would like to acknowledge the invaluable participation of the patients with cervical cancer, and to Hospital do Câncer Alfredo Abrão, staff across the accrual and patient management (Nurses, Clinicians,

Medical Oncologists and Surgeons). We also want to thank members of the Molecular Gynecology and Metabolomics Lab at EPM-UNIFESP for valuable help on Molecular Biology and Human Genetics.

Authors’ contributions

Dr. F. Colacino-Silva was the principal investigator, Dr. A.A. Siufi helped in patients’ accrual and treatment, Drs. J.P.F.O. Kleine and M.B. Salzgeber were responsible for running PCR-RFLP assays and data generation and Drs. F. Colacino-Silva, I.D.C.G. Silva and P. D’Amora were responsible for data interpretation and for the manuscript writing.

 

MissingLinkText

 

MissingLinkText

 

MissingLinkText

Competing interests:

Authors have no conflicts of interest to disclose.

• REFERENCES

• 1 Giuliano AR, Harris R, Sedjo RL, Baldwin S, Roe D, Papenfuss MR. Incidence, prevalence, and clearance of type-specific human papillomavirus infections: the Young Women’s Health Study. J Infect Dis 2002; 186 (04) 462-9
• 2 Wood RD, Mitchell M, Sgouros J, Lindahl T. Human DNA repair genes. Science 2001; 291 (5507) 1284-9
• 3 Wang SS, Gonzalez P, Yu K, Porras C, Li Q, Safaeian M, Rodriguez AC, Sherman ME, Bratti C, Schiffman M, Wacholder S, Burk RD, Herrero R, Chanock SJ, Hildesheim A. Common genetic variants and risk for HPV persistence and progression to cervical cancer. PLoS One 2010; 5 (01) e8667
• 4 Wang SY, Peng L, Li CP, Li AP, Zhou JW, Zhang ZD, Liu QZ. Genetic variants of the XRCC7 gene involved in DNA repair and risk of human bladder cancer. Int J Urol 2008; 15 (06) 534-9
• 5 Francisco G, Menezes PR, Eluf-Neto J, Chammas R. XPC polymorphisms play a role in tissue-specific carcinogenesis: a meta-analysis. Eur J Hum Genet 2008; 16 (06) 724-34
• 6 Britten RA, Liu D, Tessier A, Hutchison MJ, Murray D. ERCC1 expression as a molecular marker of cisplatin resistance in human cervical tumor cells. Int J Cancer 2000; 89 (05) 453-7
• 7 Norppa H. Cytogenetic biomarkers. IARC Sci Publ. 2004: 179-205 Review; (157)
• 8 Gangwar R, Mittal B, Srivastava S, Singh H, Mittal RD. Genetic variants of DNA repair gene XPC modulating susceptibility to cervical cancer in North India. Oncol Res 2010; 18 (07) 329-35
• 9 Ricceri F, Guarrera S, Sacerdote C, Polidoro S, Allione A, Fontana D, Destefanis P, Tizzani A, Casetta G, Cucchiarale G, Vineis P, Matullo G. ERCC1 haplotypes modify bladder cancer risk: a case-control study. DNA Repair (Amst) 2010; 9 (02) 191-200
• 10 Gangwar R, Ahirwar D, Mandhani A, Mittal RD. Do DNA repair genes OGG1, XRCC3 and XRCC7 have an impact on susceptibility to bladder cancer in the North Indian population?. Mutat Res 2009; 680 (01) 56-63 2
• 11 Pachkowski BF, Winkel S, Kubota Y, Swenberg JA, Millikan RC, Nakamura J. XRCC1 genotype and breast cancer: Functional studies and epidemiologic data show interactions between XRCC1 codon 280 His and smoking. Cancer Res 2006; 66 (05) 2860-8
• 12 Caldecott KW. XRCC1 and DNA strand break repair. DNA Repair (Amst) 2003; 2 (09) 955-69 Review
• 13 Schild D, Lio YC, Collins DW, Tsomondo T, Chen DJ. Evidence for simultaneous protein interactions between human Rad51 paralogs. J Biol Chem 2000; 275 (22) 16443-9
• 14 Thompson LH, Schild D. Recombinational DNA repair and human disease. Mutat Res 2002; 509 (01) 49-78 2
• 15 Altekruse SF, Lacey Jr JV, Brinton LA, Gravitt PE, Silverberg SG, Barnes Jr WA. et al. Comparison of human papillomavirus genotypes, sexual, and reproductive risk factors of cervical adenocarcinoma and squamous cell carcinoma: Northeastern United States. Am J Obstet Gynecol 2003; 188 (03) 657-63
• 16 Iyer L, Ratain MJ. Pharmacogenetics and cancer chemotherapy. Eur J Cancer 1998; 34 (10) 1493-9
• 17 Giuliano AR, Harris R, Sedjo RL, Baldwin S, Roe D, Papenfuss MR. et al. Incidence, prevalence, and clearance of type specific human papillomavirus infections: The Young Women’s Health Study. J Infect Dis 2002; 186 (04) 462-9
• 18 McLeod H, Papageorgio C, Watters JW. Using genetic variations to optimize cancer chemotherapy. Clin Adv Hematol Oncol 2003; 1 (02) 107-11

Publication History

Received: 19 January 2017

Accepted: 25 January 2017

Article published online:
25 February 2025