Keywords
QRDR - Plasmid - GyrA
Introduction
Klebsiella pneumoniae is a clinically important pathogen which causes a wide range of infections.[1] It is the most common of the fluoroquinolone-resistant bacteria among Enterobacteriaceae.[2] Ciprofloxacin is a fluoroquinolone frequently administered to treat bacterial infections.[3] The emergence of fluoroquinolone resistance is rapidly rising due to its broad-spectrum
of activity and consequent high-usage in the treatment of infectious disease.[4]
Resistance to fluoroquinolone is mediated by several mechanisms. The major mechanism
is the chromosomal mutation at quinolone resistance determining regions (QRDR) encoded by DNA gyrases (gyrA and gyrB genes) and topoisomerase IV (parC and parE genes).[5]
The other mechanism of resistance is plasmid-mediated quinolone resistance (PMQR)
and this was first reported in 1998 in a clinical isolate of K. pneumoniae.[6] The three PMQR mediators are the qnr proteins (qnrA, qnrB and qnrS) that protect the target enzymes encoding DNA gyrase and topoisomerase IV. Yet another
mechanism attributed to fluoroquinolone resistance is the acc(6̍)-Ib-cr gene, encoding a variant of aminoglycoside transferase which acetylates certain fluoroquinolones
also. The qepA and oqxAB are specific efflux pump encoding genes that extrude fluoroquinolone from bacterial
cell, thus contributing to resistance.[7]
PMQR determinants confer low-level resistance to fluoroquinolones, and they provide
a favorable background for the selection of additional chromosomally encoded fluoroquinolone
resistance mechanisms.[8] Recently, PMQR is increasingly being reported worldwide.
The purpose of this study was to determine the presence of QRDR mutation genes and
PMQR determination in clinical isolates of ciprofloxacin-resistant K. pneumoniae.
Methods
Bacterial Isolates
This study included 110 nonduplicate clinical isolates of ciprofloxacin-resistant
K. pneumoniae obtained from hospitalized patients admitted to a tertiary healthcare hospital. The
source of the clinical isolates were exudates (n = 88), respiratory secretions (n = 5), and blood (n = 17), and these were collected from June 2014 to May 2015. The bacterial identity
was performed by automated (VITEK2 GN-card; BioMerieux, Brussels, Belgium) and conventional
methods.
Antimicrobial Susceptibility Testing
The Kirby–Bauer Disk diffusion method and minimal inhibitory concentration (MIC) was
performed in accordance with the Clinical Laboratory Standards Institute guidelines
(CLSI 2017).[9] ATCC Escherichia coli 25922 was used as a control for both disc diffusion method and MIC. The antibiotics
tested by disc diffusion method were as follows: levofloxacin (5 µg), ciprofloxacin
(5 µg), and ofloxacin (5 µg) (Hi-media, Mumbai). MIC was determined by agar dilution
assay for ciprofloxacin (Sigma-Aldrich, India).
Preparation of Media and Antibiotic Solution
MIC was determined using concentration derived from serial two-fold dilution indexed
to the base 2 (e.g., 1, 2, 4, 8µg/mL). Two mL of various serial two-fold dilutions
of the antimicrobial agent was added to 18 mL molten MHA agar. The inoculum was prepared
by mixing colonies in peptone water obtained from an overnight culture of Gram negative
clinical isolates grown on MacConkey Agar plate (MAC) (Himedia Laboratories, India).
The agar plate with the concentration of the drug at which there were was no growth
was taken as the minimum inhibitory concentration.
Polymerase Chain Reaction (PCR)
The DNA of the study isolates was extracted by the boiling method.[10] The QRDR mutation genes (gyrA, gyrB, parC and parE) were detected by using specific primers,[11] and the PCR conditions were as follows: 94°C for 3 minutes, followed by 35 cycles
of denaturation at 94°C for 30 seconds, annealing at 55°C for gyrA and parE, 58°C for gyrB, and 52°C for parC for 30 seconds, with extension at 72°C for 50 seconds, and a final extension at 72°C
for 10 minutes. The amplification of qnr genes (qnrA, qnrB and qnrS) was performed by multiplex PCR using the cyclic profile: initial denaturation at
94°C for 7 minutes; denaturation at 94°C for 50 seconds, annealing at 53°C for 40
seconds, and elongation at 72°C for 60 seconds, repeated for 35 cycles, and a final
extension at 72°C for 5 minutes.[12] PCR conditions for acc (6̍)-Ib-cr were: initial denaturation at 94°C for 7 minutes, denaturation at 94°C for 50 seconds,
annealing at 55°C for 40 seconds, and elongation at 72°C for 60 seconds, repeated
for 35 cycles, and a final extension at 72°C for 5 minutes. The PCR cyclic parameters
for oqxAB were as follows: initial denaturation at 95°C for 15 minutes; 30 cycles of 94°C for
30 seconds, 63°C for 90 seconds, and 72°C for 90 seconds; followed by a final extension
at 72°C for 10 minutes. The PCR condition used for qepA were as follows: initial denaturation at 96°C for 1 minute, followed by 30 cycles
of amplification at 96°C for 1 minute, annealing at 60°C for 1 minute, extension at
72°C for 1 minute, and the final extension step was at 72°C for 5 minutes.[13]
[14] The primers used are given in [Table 1]. The PCR product was examined by electrophoresis in 1.5% agarose gel containing
ethidium bromide and visualized by gel documentation system.
Table 1
Primers used in this study
|
Gene
|
Primers
|
Product size
|
|
gyrA
|
GGATAGCGGTTAGATGAGC
CGTTCACCAGCAGGTTAGG
|
521
|
|
gyrB
|
CAGCAGATGAACGAACTGCT
AACCAAGTGCGGTGATAAGC
|
376
|
|
parC
|
AATGAGCGATATGGCAGAGC
TTGGCAGACGGGCAGGTAG
|
487
|
|
parE
|
GCTGAACCAGAACGTTCAG
GCAATGTGCAGACCATCAGA
|
426
|
|
qnrA
|
5-TCAGCAAGAGGATTTCTCA-3
5-GGCAGCACTATTA CTCCCA-3
|
516
|
|
qnrB
|
5-GATCGTGAAAGCCAGAAAGG3
5-ACGATG CCTGGTAGTTGTCC-3
|
469
|
|
qnrS
|
5-ACGACATTCGTCAACTGCAA-3
5-TAAATTGGCACCCTGTAGGC-3
|
417
|
|
acc (6')-Ib-cr
|
5-TTGGAAGCGGGGACGGAM-3
5-ACACGGCTGGACCATA -3
|
260
|
|
oqxAB
|
5- CCGCACCGATAAATTAGTCC-3
5-GGCGAGGTTTTGATAGTGGA-3
|
313
|
|
qepA
|
5 -GCA GGT CCA GCA GCG GGT AG-3
5 -CTT CCT GCC CGA GTA TCG TG-3
|
199
|
Nucleotide Sequence
The PCR positive amplicons were sequenced by SciGenome Labs PVT. Ltd, India, and analyzed
with BLAST tools (www.ncbi.nim.nih.gov).
The assigned Genbank accession numbers for the submitted sequences are as follows:
MH709267 (gyrA); MH709268 (gyrB); MK318818 (parC); MK318819 (parE); MH709266 (qnrA); KY130487 (qnrB); KY130488 (qnrS); MH709269 (acc (6̍)-Ib-cr); MH709851 (oqxAB).
Conjugation Assay
Conjugation assay was performed to study the transfer of plasmid from qnr positive isolates which were used as donors. Escherichia coli J53 AziR strain was used as recipient. The mating was performed in logarithmic phase
by adding the donor and recipient cells (0.5 mL each) in 3 mL of Luria–Bertani broth
and incubated overnight at 37 C. Transconjugants were selected on Macconkey agar plates
containing sodium azide (100 µg/mL) and ciprofloxacin (0.5 µg/mL).[15] The transconjugants were analyzed by PCR to determine the transferability of PMQR
determinants.
Results
Antimicrobial Susceptibility Testing
MIC to ciprofloxacin ranged from 4 µg/mL to ≥256 µg/mL. MIC50 and MIC90 were 32 µg/mL and 128 µg/mL, respectively. All 110 isolates were resistant to ciprofloxacin,
levofloxacin, and ofloxacin.
Distribution of QRDR and PMQR Genes
Among the 110 study isolates, 94 (85%) harbored gyrA and 85 (77%) gyrB. The parC and parE genes were detected in 88 (80%) and 64 (58%) isolates. Combination of the above four
genes was found in 56 (51%) isolates. ([Table 2]). Of the eighteen (16%) isolates which harbored the qnr genes, qnrB was detected in 13 (12%) isolates and qnrS in 5 (4.5%) isolates. Two (1.8%) isolates carried both qnrB and qnrS genes. The acc (6̍)-Ib-cr gene was found in 98 (89%) isolates and oqxAB was detected in7 (6.3%) isolates. One (0.9%) isolate carried qnrB, acc (6̍)-Ib-cr and oqxAB genes ([Table 3]). Notably, qnrA and qepA were not detected in any of the study isolates.
Table 2
Distribution of quinolone resistance chromosomal mutation genes
|
QRDR genes
|
No. of positive (n = 110)
|
|
gyrA
|
94 (85%)
|
|
gyrB
|
85 (77%)
|
|
parC
|
88 (80%)
|
|
parE
|
64 (58%)
|
|
gyrA + gyrB
|
2 (1.8%)
|
|
gyrA + parE
|
6 (5.4%)
|
|
gyrB + parE
|
4 (3.6%)
|
|
gyrA + gyrB + parC
|
28 (25%)
|
|
gyrA + parC + parE
|
9 (8.1%)
|
|
gyrB + parC + parE
|
2 (1.8%)
|
|
gyrA + gyrB + parC + parE
|
5 (4.5%)
|
Table 3
Distribution of plasmid-mediated quinolone resistance genes
|
PMQR genes
|
No. of positives (n = 110)
|
|
qnrB
|
13 (11.8%)
|
|
qnrS
|
5 (4.5%)
|
|
acc (6’)-Ib- cr
|
98 (89%)
|
|
oqxAB
|
7 (6.3%)
|
|
qnrB + qnrS
|
2 (1.8%)
|
|
qnrB + qnrS + acc (6’)-Ib– cr + oqxAB
|
1 (0.9%)
|
PMQR Gene Transfer
Of the 18 qnr determinants, 11 (61%) were successfully transconjugated. Among them, eight (44%)
harbored the qnrB and three (17%) harbored qnrS gene.
Among the qnrB transconjugants, four (22%) also carried acc (6̍)-Ib-cr, and one coharbored the acc (6̍)-Ib-cr and oqxAB. qnrB alone was present in three transconjugants. Of the three qnrS transconjugants, one (5.5%) coharbored acc (6̍)-Ib-cr.
Discussion
Fluoroquinolones are the most important antibacterial agents used for the treatment
of bacterial infections.[16] Recently, bacterial resistance to fluoroquinolones has increased in clinical isolates.
The most common resistance mechanism of fluoroquinolones are the chromosomal mutations
in QRDR and PMQR.[17] In the present study, 110 ciprofloxacin-resistant clinical isolates of K. pneumoniae were screened to determine the prevalence of QRDR mutation genes and PMQR determinants.
In this study, a majority (88%) of isolates exhibited high-level of MIC to ciprofloxacin.
The gyrA gene (85%) was encountered most frequently followed by parC (80%), gyrB (77%), and parE (58%). Similar high-prevalence rate for mutations in gyrA has been reported by Alisha et al from Iran and Muthu et al from India.[18]
[19] Although the gyrA and parC are most commonly reported, mutation-resistant genes in the QRDR regions, in the
current study, gyrB and parE genes were also frequently encountered.
In this study, qnrB gene (12%) was more prevalent than qnrS (4.5%). qnrA was not found in any isolate. Our results are consistent with the findings of previous
studies.[20]
[21]
[22]
[23]
[24] A study from Korea reported high-prevalence of qnrS (26.6%) as compared with qnrB (6.5%) and qnrA was not detected.[25] Mahesh et al and Tripathi et al from India observed qnrA and qnrB in clinical isolates, whereas qnrS was not detected.[26]
[27] In few studies, all the three qnr genes (qnrA, qnrB and qnrS) have been found in clinical isolates.[8]
[28]
[29] The types of qnr genes may vary in different geographical locations.[30] Conjugation experiment demonstrated that 61% of qnr determinants are transferable, where one transconjugant carrying multiple PMQR genes
was documented. This transferability rate is high compared with previous studies.[31]
[32]
[33]
In the present study, the prevalence of oqxAB gene (6.3%) was very low as compared with previous reports.[23]
[29]
[31] Thus, indicating that it may not be a major mediator of fluoroquinolone resistance.
qepA gene was not detected in the present study and similar findings has been documented
from Thailand and Iran.[34]
[35] In contrast, qepA gene was detectable in a study conducted by Majida et al, and in the same study,
oqxAB was notably absent.[30] However, from India, only a few studies have reported oqxAB and qepA genes in Enterobacteriaceae.
In this study, acc (6̍)-Ib-cr was predominantly present along with PMQR genes. Similar to this result, a high-prevalence
was noted in Iran, Korea and Israel.[22]
[35]
[36] In agreement to the previous reports, all the qnr determinants were positive for acc (6̍)-Ib-cr gene.[37]
[38]
[39]
[40] A high-frequency of the combined occurrence of acc (6̍)-Ib-cr and QRDR mutations and PMQR determinants in multidrug resistant K. pneumoniae has been reported from Brazil.[8] Limited data have been reported on the prevalence of fluoroquinolone resistance
in India. These results suggest that the emergence of the PMQR would contribute to
a rapid increase and spread in bacterial resistance to fluoroquinolones, which requires
continuous surveillance and monitoring of antibiotic use. The limitation of this study
is the lack of analysis of efflux pump activity.
Conclusion
The current study demonstrated a high prevalence of aac (6’)-Ib-cr gene among PMQR determinants. The transferability rate of these determinants is high.
This is a cause for concern, since horizontal transfer of PMQR genes can increase
the spread of fluoroquinolone resistance among clinical isolates.
