Keywords bispecific nanobody - HER2 - VEGFR2 - colorectal cancer
Introduction
Colorectal cancer (CRC) is a common malignancy of the digestive tract, which accounts
for a significant portion of cancer-related deaths around the world.[1 ] While human epidermal growth factor receptor 2 (HER2), a member of the ErbB family,
is expressed on the surface of normal endothelial cells, it is often overexpressed
on tumor cells,[2 ] causing tumors with elevated HER2 expression highly invasive. Vascular endothelial
growth factor receptor 2 (VEGFR2) is involved in the regulation of angiogenesis, therefore,
inhibiting VEGFR2 activity, and the downstream signaling pathway has become an important
approach in cancer treatment.[3 ]
[4 ]
[5 ] Overexpression of HER2 can upregulate VEGF through the PI3K signaling pathway, so
blocking HER2 significantly decreases VEGF expression and helps killing the tumor
cells.[3 ]
[6 ] In addition, based on the synergetic effect and cross-talk between the signaling
pathways, targeting both receptors simultaneously may more effectively inhibit tumor
cell proliferation and promote apoptosis. To date, chemotherapy has been widely used
for clinical cancer treatment, but long-term use of these agents will lead to drug
resistance and bone marrow suppression.[7 ] To reduce the side effects on cancer patients, approaches with targeted drug delivery
represent a better choice. Novel genetic mechanisms in gene expression and targeting
have been reported in the last several years.[8 ] Targeted drugs are delivered specifically to the site of tumor, so they can be concentrated
there and more effectively kill the tumor cells, and meanwhile, exert less damage
to normal tissue.[9 ]
[10 ]
[11 ]
[12 ] Antibodies and bispecific antibodies have become the most important part of targeted
tumor therapy.[13 ]
[14 ]
[15 ]
[16 ] Bispecific Antibody by Protein Trans-Splicing (BAPTS) has been reported to synthesize
BsAbs with natural human immunoglobulin G (IgG) structure and no chain mispairing.[17 ]
[18 ] Nanobodies, such as camel-derived antibodies, that naturally lack the light chains
and contain only the variable region of the heavy chain are the smallest antigen-binding
fragments.[19 ] Compared with traditional monoclonal antibodies, nanobodies have the advantages
of small size, high solubility, high stability, high affinity to their targets, low
immunogenicity, and excellent tissue penetration.[20 ]
[21 ] Based on the characteristics of nanobodies and the special structure of VHH of the
natural heavy-chain antibody,[21 ]
[22 ] previously our laboratory has shown that nanobodies combined with immunotoxin improve
antitumor activity.[23 ] In this study, we developed a bispecific nanobody (Bi-Nb) using anti-HER2 and anti-VEGFR2
nanobodies. This Bi-Nb targets simultaneously HER2 and VEGFR2 in tumor cells overexpressing
these two receptors,[24 ]
[25 ] which holds greater potential in medical research and clinical treatment of cancer.
Materials and Methods
Cell Lines and Reagents
The HT-29 cells used in this study were preserved in our laboratory and cultured on
the McCoy's 5A medium (McCoy's 5A; Gibco, United States), supplemented with 10% (v/v)
fetal bovine serum (FBS; Gibco, USA) and 1% (v/v) penicillin/streptomycin (P/S; Hyclone,
United States). All the cultures were kept in a plastic flask and incubated at 37°C
in 5% CO2 . The Cell Counting Kit-8 (CCK-8) kit was purchased from Dongren Chemical Technology
(Shanghai) Co., Ltd., BCA kit was purchased from Shanghai Biyuntian Biotechnology
Co., Ltd., and Ni-NTA gel from Nanjing Kingsley Co., Ltd. Yeast extract, tryptone,
and peptone were purchased from OXOID Co., Ltd. Flow cytometry used in this study
was CytoFlex from Beckman. VEGFR2 antibody (2C6) was purchased from Novus Biologicals
(United States). VEGF165 and PE-conjugated VEGFR2 antibody were purchased from Sino
Biological (Beijing, China). FITC-conjugated rat anti-mouse IgG1 secondary antibody
and FITC-conjugated 6 × His tag mAb (AD1.1.10) were purchased from Thermo Fisher (United
States).
Construction and Expression of Bispecific Nanobody
The 2D3 and Bi-Nbs were synthesized by Synbio Technologies (Soochow, China). The sequence
information of the anti-HER2 2D3 nanobody was obtained from Ablynx.[25 ] The sequence information of the anti-VEGFR2 3VGR19–3 nanobody was provided by our
laboratory. Then they were cloned into plasmid pET-22b(+) between restriction sites
NcoI and XhoI. Primers used were T7 and T7 terminals. The above three nanobodies were
confirmed by sequencing. The constructed plasmid was transformed into Escherichia coli strain BL21 (DE3). Inoculum 1% (v/v) was inoculated to 1 L culture, and 1 mmol/L
IPTG inducer was added when the OD600 value of the bacterial liquid reached 0.5 to 0.6. After centrifugation (12,000 r/min,
10 minutes), periplasmic protein was extracted by osmotic shock and purified by an
affinity metal chromatography column (nickel column), then analyzed by 15% SDS-PAGE
and Western blotting with anti-His tag mouse antibody.
Surface Plasmon Resonance Kinetics Measurements
Affinity constants for the binding between Bi-Nb and VEGFR2 or HER2 were determined
by surface plasmon resonance (SPR) analysis using the Biacore T200 system. The VEGFR2
or HER2 was immobilized on the CM-5 sensor chip. There are four channels on the CM-5
sensor chip, two coupling VEGFR2 or HER2 interaction detection channels and two nonfixed
VEGFR2 or HER2 as blank reference channels. At a flow rate of 30 μL/min, HBS solution
was used as the working solution, and the gradient concentrations of nanobodies were
injected respectively, each concentration was detected twice. All Biacore kinetics
experimental data were obtained using the Biacore T200 evaluation software to estimate
the association rate constant (k
a ) and dissociation rate constant (k
d ).
Flow Cytometry Analysis
After washing three times with phosphate buffered saline (PBS)-2% FBS, 2× 105 HT-29
cells were incubated at 4°C for 30 minutes with 1 mg/mL nanobodies (2D3, 3VGR19–3,
and Bi-Nb) in PBS-2% FBS. After three times washing with PBS-1% BSA (w/v), cells were
incubated with anti-His-tag FITC antibody for 30 minutes on ice. Excess fluorescein-labeled
antibody was removed by washing with PBS-2% FBS. Then, the cells were fully suspended
with 400 μL PBS and analyzed by flow cytometry.
CCK-8 Cell Proliferation Assay
The CCK-8 assay kit (Sigma-Aldrich) was used to detect the effect of nanobodies on
the cell viability of HT-29 cells. Briefly, the starved cells were seeded into separate
96-well plates at 3,000 cells/well and cultured overnight at 37°C. At the end of incubation,
10 μL CCK-8 was added to each well, and the cells were counted by absorbance measurements
at a wavelength of 450 nm. The cell survival rate (%) of the target cells was calculated
using the following formula: [(A
s – A
b )/(A
0 –A
b )] × 100%, where A
s , A
b , and A
0 are the absorbent values of the sample group, respectively. The IC50 values were then calculated by curve fitting using the GraphPad Prism software (San
Diego, United States).
Apoptosis Assay
Apoptosis assay was performed with an Annexin V-FITC/propidium iodide (PI) kit (Lianke,
Hangzhou, China). A total of 5 × 105 HT29 cells were seeded in a 6-well plate. After adding the apoptosis-inducing agent,
the cells were incubated at 37°C for 48 hours, then stained with PI and Annexin V-FITC
for apoptosis assay on a flow cytometer. Anenxin V-FITC/PI double staining can detect
cell apoptosis and differentiate into early apoptotic cells (annexin V+ /PI− ), late apoptotic cells (annexin V+ /PI+ ) and necrotic cells (annexin V− /PI+ ) Apoptosis. The percentage of apoptotic cells was calculated as the total percentage
of early apoptotic cells and late apoptotic cells.
Results
Construction, Expression, and Purification of the Bi-Nb
The construction of the mono-Nb and Bi-Nb is illustrated in [Fig. 1 ] and [Table 1 ]. We designed forward and reverse primers for plasmid construction and subcloned
them into the vector pET-22b (+). The target gene sequence was confirmed by DNA sequencing.
The sequence information of 2D3, 3VGR19–3, and Bi-Nb was confirmed by sequencing.
The genes of interest were expressed in E. coli ; six anti-His tags were added and purified with a nickel column. 2D3 and 3VGR19–3
were present as a single band of 14kDa ([Fig. 1A ]). Bi-Nbs were constructed by linking two nanobodies, anti-VEGFR2 and anti-HER2,
with a (G4S)3 linker. The recombinant protein was present as a single band of ∼28 kDa
([Fig. 1B ]). The final yield was 5 mg/L for 2D3, 1 mg/L for 3VGR19–3, and 4 mg/L for the Bi-Nb.
Fig.1 (A ) Basic structure of anti-HER2 nanobody, anti-VEGFR2 nanobody, and bispecific nanobody.
(B ) Coomassie-stained SDS-PAGE and Western blotting analysis of the purified Bi-Nb and
the Nbs. Expression and purification of 2D3 (1, 2). Expression and purification of
3VGR19–3 (3, 4). Expression and purification of bispecific nanobody (5, 6). L is (G4S)3
(GGCGGCGGTGGTAGCGGCGGCGGCGGTTCCGGCGGTGGTGGTTCT) linker, M is size standards. PSP,
periplasmic space protein; FT, flow through by IMAC; E20–E500, elution samples with
20–500 mmol/L imidazole.
Table 1
The Primer Sequence applied for constructing nanobodies 2D3 and 3VGR19-3[a ]
Name
Primer sequence
2D3
Primer F-2D3
ATGCGAATTCGAAGTTCAGCTGGTTGAA
Primer R-2D3
ATGCCTCGAGGCTGCTCACGGTAACTTG
3VGR19–3
Primer F-3VGR19–3
ATGCGAATTCGAAGTTCAGCTGCAGGAA
Primer R-3VGR19–3
ATGCCTCGAG AGAAGAAACGGTAACCTG
3VGR19–3 + 2D3
3VGR19–3-F′
ATGCGAATTCGAAGTTCAGCTGCAGGAA
3VGR19–3-R′
ATGCCTCGAGAGAACCACCACCGCCGGAACCGCCGCCGCCGCTACCACCGCCGCCAGAAGAAACGGTAACCTG
2D3-R′
RATGCCTCGAGGCTGCTCACGGTAACTTG
2D3-F′
TGCGAATTCGGCGGCGGTGGTAGCGGCGGCGGCGGTTCCGGCGGTGGTGGTTCTGAAGTTCAGCTGGTTGAA
a The detailed primer sequence is shown in [Table 1 ]. We amplified the target fragment by PCR on the primer sequence, then cloned into
plasmid pET-22b(+) between restriction sites NcoI and XhoI.
Bi-Nb Binding to VEGFR2/HER2 Analyzed by SPR
Evaluation of the binding of antigens VEGFR2 or HER2 with Bi-Nb was performed by SPR
analysis, as shown in [Fig. 2 ]. The SPR technology was used to detect the binding affinity of 2D3 to HER2 ([Fig. 2A ]) and 3VGR19–3 to VEGFR2 ([Fig. 2B ]). The detailed kinetic parameters are listed in [Table 2 ]. A hyperbolic curve was formed by the combination of the two antigens with the Bi-Nb
([Fig. 2E ]). Based on the results of the affinity constant, we can find that the ability of
Bi-Nb to recognize antigens is weaker than that of single-target nanobody. We consider
that the high molecular weight of Bi-Nbs limits its ability to bind to antigens.
Fig. 2 Identification of affinity between nanobody and antigen by Biacore. (A ) Determination of affinity between 2D3 and HER2. (B ) Determination of affinity between 3VGR19–3 and VEGFR2. (C ) Identification of affinity of bispecific nanobody to HER2. (D ) Identification of affinity of bispecific nanobody to VEGFR2. (A–D) The curves of
different colors represent different concentrations of nanobodies. (E ) Hyperbolic binding of two antigens to bispecific nanobodies. The red curve represents
the PBS group and the green curve represents the bispecific nanobody group. And the
two peaks show that the bispecific nanobody first binds to VEGFR2, and then binds
to HER2 at 200 seconds.
Table 2
Affinity constants of nanobodies to HER2 or VEGFR2 by Biacore analysis[a ]
Nbs
Targets
K
a /mol−1 L s−1
K
d /s−1
K
D /mol L−1
2D3
HER2
1.342E+6
0.002768
2.063E−9
3VGR19–3
VEGFR2
4.388E+5
1.505E−4
3.430E−10
Bi-Nb
HER2
5.565E+5
0.001579
2.838E−9
Bi-Nb
VEGFR2
9.509E+4
2.978E−4
3.132E−9
a The association and dissociation constants (K
a , K
d ) were calculated using the Biacore T200 evaluation software. K
D was calculated from the quotient of K
d
/ K
a .
Affinity Analysis of the Nanobodies to HT-29 Cell Surface Antigen
The ability of individual nanobody and Bi-Nb for the recognition of receptor on the
HT29 cell surface was analyzed by flow cytometry. The results showed that 2D3, 3VGR19–3,
and Bi-Nb bound to HER2 or VEGFR2 in HT-29 cells ([Fig. 3 ]). 2D3, 3VGR19–3, and Bi-Nb had certain affinity to antigen in HT-29 cells; therefore,
we chose to use HT29 cells to detect the efficacy of antibodies for against tumors.
Fig. 3 Flow cytometry analysis results showing that bispecific nanobody binds to VEGFR2
and HER2 co-expressing HT-29 cells. In the process of detection, positive control
HER2 (A ) and positive control VEGFR2 (B ) were found respectively.
Bi-Nb Inhibits the Proliferation of HT29 Cells
The biological activities of the nanobodies were tested by the CCK-8 kit assay, such
as inhibition of cell proliferation, migration, and induction of cell apoptosis were
verified. Inhibition of cell proliferation may indicate a possibility for cancer treatment.
We measured cell viability in HT29 cells treated with different concentrations of
nanobody or Bi-Nb using CCK-8 assays. The results are shown in [Fig. 4 ]. The IC50 value of 2D3 was 168.2 nmol/L, that of 3VGR19–3 was 584.4 nmol/L, while that of the
Bi-Nb was 101.2 nmol/L.
Fig. 4 CCK-8 kit showing that bispecific nanobody inhibited HT-29 cell growth nanobody or
Bi-Nb inhibited the proliferation of HT29 in a dose-dependent manner. A CCK-8 assay
was performed on HT29 (3 × 103 cells/well). The IC50 values were calculated by curve fitting using the GraphPad Prism software (values
represented as means ± SD, n = 3).
Bi-Nb Induces Apoptosis
As shown in [Fig. 5 ], HT29 cells were treated with 200 nm nanobody, followed by apoptosis assay with
the FITC-Annexin V/PI kit to determine cytotoxicity of the nanobodies to the cells,
and then with annexin V-FITC and PI to distinguish populations of early apoptotic
(annexin V+ /PI− ), late apoptotic (annexin V+ /PI+ ) cells. The results showed that the Bi-Nb was more effective in inducing apoptosis
of the tumor cells.
Fig. 5 After treatment specified for each group, HT29 cells exposed to 200 nm concentrations
of nanobodies were stained with Annexin V-FITC and PI (p < 0.05). 2D3 or 3VGR19–3 could decrease the percentage of proliferating HT29 cells
by ∼30%, from 93.5% to 74.5% or 65.0%. Treatment with Bi-Nb markedly increased apoptosis
in HT29 cells from 6.5% (early apoptosis 3.57% plus late apoptosis 2.93%) to ∼55%
(p < 0.05). Q1UL, necrotic; Q2UR, late apoptotic; Q3LR, early apoptotic; Q4LL, live.
Discussion and Conclusions
Discussion and Conclusions
Studies on CRC risk have identified potential factors associated with the disease.[26 ]
[27 ]
[28 ]
[29 ]
[30 ] A close correlation has been detected between HER2 overexpression and elevated VEGF
in several human tumors, especially breast cancer.[31 ]
[32 ] Simultaneously blocking HER2 and VEGFR2 signaling pathways with the Bi-Nb may overcome
the drug resistance commonly seen after treatments targeting only one of them and
produce synergistic antitumor effects, which would be of great clinical significance.[33 ]
[34 ]
[35 ] We chose to use the (G4S)3 linker to bind the two nanobodies together for constructing
the novel Bi-Nb ([Fig. 1A ]). The results showed that ([Fig. 1B ]) the expression level of Bi-Nb was the same as that of single nanobody and could
be effectively secreted in periplasmic protein. The transient gene expression technology
platform has been widely used in a variety of therapeutic proteins and monoclonal
antibodies.[36 ]
[37 ]
[38 ] Compared with the traditional Bi-Nbs, this Bi-Nb not only has a high yield, but
also is easy to be purified. We consider that the high yield of the Bi-Nb may be due
to its small molecular weight, high solubility, and the high expression of target
protein in the prokaryotic system.[39 ] In addition, in the process of purification, the proteins in the periplasmic space
were used as the mother liquor for gradient elution, but there were fewer miscellaneous
proteins in the cell periplasmic space, so it was easier to purify the target protein.
The results of SPR and fluorescence-activated cell sorting showed that the Bi-Nb could
target HER2 and VEGFR2. Next, biological activities or anticancer activities in vitro
were evaluated by cell proliferation assay and apoptosis assay. The Bi-Nb inhibited
HT29 cell proliferation in a dose-dependent manner, with an IC50 of ∼100 nmol/L ([Fig. 4 ]). Treatment with Bi-Nb markedly increased apoptosis in HT29 cells from 6.5 to 55%
([Fig. 5A ]). These observations collectively suggested that the Bi-Nb demonstrated biological
function of inhibition of cell proliferation, migration, and apoptosis in vitro. As
the Bi-Nb has been successfully constructed and its efficacy against tumor cells has
been preliminarily validated, the next stage of the study seeks to evaluate its efficacy
in animal models. Generally, the Bi-Nb still has some limitations in clinical application.
It is believed that blocking neovascularization would effectively inhibit tumor growth,
but once the drug is withdrawn, relevant signaling pathways would be activated again,
and the tumor would resume vascularization and continue growing.[40 ] As seen in renal cell carcinoma treated with bevacizumab alone, tumors grow rapidly
during the intervals of treatment. To address this problem, we shall further combine
toxins with nanobodies into immunotoxins, or with other antitumor drugs. This study
provides a new perspective for clinical treatment of tumor.
