Introduction
Glucocorticoids are well known as stress hormones that show rapid increases after
stress, and it has been confirmed to have critical and complex functions during triglyceride
(TG) metabolism. Depending on the physiological state, glucocorticoids have been proposed
to be both adipogenic and lipolytic in their actions within adipose tissue [1]
[2]
[3]
[4]
[5]. Therefore, understanding their effects on the regulation of adipose tissue metabolism
is critical in determining the correlation between stress and obesity. Although a
number of studies about the influence of glucocorticoids on lipid metabolism has been
reported [6]
[7]
[8], the specific mechanism of glucocorticoids on lipid metabolism is still largely
unknown.
Previous studies have shown that adipogenesis is regulated by various adipogenic transcription
factors, such as C/EBPs (CCTTA enhancer binding protein), PPARs (peroxisome proliferators-activated
receptor), HSL (hormone sensitive lipase), and FAS (fatty acid synthase), which are
expressed as a transcriptional cascade that promotes adipocyte differentiation, ultimately
leading to the mature adipocyte phenotype [9]. The PPAR and C/EBP family are considered to be the master regulators of adipogenesis,
despite other transcription factors positively or negatively regulate adipogenesis
[10]. The PAT protein family is the main protein family expressed on the surface of lipid
droplets, and perilipin wraps the surface of lipid droplets in mature fat cells [11]. The degree of adipocyte differentiation can be determined by the expression level
of perilipin. How these genes mediate glucocorticoid action on lipid metabolism, and
whether miRNAs (microRNAs) can be involved during the process is unclear.
MiRNAs are an emerging class of highly conserved, endogenously expressed noncoding
small RNAs (usually 19–25 nucleotides long) that are involved in the post-transcriptional
regulation of gene expression by targeting mRNAs, leading to mRNA degradation or translation
inhibition [12]
[13]. miRNA expression is often tissue specific and developmentally regulated [14]. In recent years, accumulated evidences have shown that miRNAs are aberrantly expressed
in fat tissue and play a vital role as a novel class of genes related to adipocyte
differentiation and lipid metabolism [15]
[16]. miR-335 levels are closely correlated with the expression levels of adipocyte differentiation
markers, such as PPAR-γ, aP2 (adipocyte protein 2) and FAS in 3T3-L1 adipocytes [17]. miR-378/378* overexpression in ST2 mesenchymal precursor cells increases the size
of lipid droplets due to the increased expression of PPAR-γ2. At present, 306 mature
miRNAs have been identified in Sus scrofa (www.miRbase.org.com), yet the function of most miRNAs is still unknown.
Therefore, in the present study, we treated primary culture of porcine preadipocytes
with dexamethasone to investigate the influence of glucocorticoid on adipocyte maturation
and identify specific roles of the miRNAs involved in this process. The study will
further clarify the regulatory mechanism of glucocorticoid on adipocyte differentiation,
and provide a new light for further regulation of porcine lipid metabolism.
Materials and Methods
Primary culture of porcine preadipocyte
Meishan piglets aged 35 days were killed by exsanguination in a manner approved by
the Nanjing Agricultural University Institutional Animal Care and Use Committee. Porcine
preadipocytes from 5 piglets were isolated according to published protocols [18]
[19] with the following modifications and pooled together. Subcutaneous adipose tissue
was collected from the neck and back of the piglets and rinsed with serum-free DMEM/F-12
medium (Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12) supplemented with
15 mM NaHCO3, 100 IU/ml penicillin, and 100 IU/ml streptomycin. The tissue mass was cut with scissors
into fine pieces and digested with type IV collagenase (GIBCO) (Invitrogen Life Technologies,
Carlsbad, CA, USA) (DMEM/F-12 + 20 g/l BSA + 1 g/l type IV collagenase) at 37°C in
a shaking water bath for approximately 1 h. Then, DMEM/F-12 medium (Invitrogen) containing
10% fetal bovine serum (FBS) (Invitrogen) was added to stop digestion. The solution
was filtered through sterile nylon meshes (150 μm pore size, 75 μm pore size, 38 μm
pore size, and 23 μm pore size) to remove undigested tissue. The filtrate was centrifuged
at 1 000 rpm for 10 min to separate the floating adipocyte cells from the pellet of
porcine preadipocytes. The preadipocytes were then incubated with erythrocyte lysis
buffer (0.154 M NH4Cl, 10 mM KHCO3, and 0.1 mM EDTA) at room temperature for 10 min [20], followed by centrifugation at 800 rpm for 5 min. The preadipocytes pellet was washed
with DMEM/F-12, centrifuged, and resuspended in plating medium (20% FBS, DMEM/F-12).
Finally, the preadipocytes were seeded in culture plates at a density of 3×105 cells/cm2 and cultured at 37°C in a humidified atmosphere containing 5% CO2. The medium was changed every second day.
Adipogenic differentiation of preadipocytes
Cultured preadipocytes were maintained in plating medium until 85–90% confluence.
Then, to induce differentiation, the cultures were exposed to medium (without FBS)
containing ITS (5 U/ml insulin, 5 μg/ml transferring, and 5 ng/ml selenium; Sigma,
St. Louis, MO, USA), 400 μM oleic acid (Sigma), and BSA (Invitrogen) for 48 h, with
a 6:1 ratio of oleic acid to BSA. All cells were divided into 4 groups (control; 10 − 6 M dexamethasone; 10 − 6 M RU486; 10 − 6 M dexamethasone and 10 − 6 M RU486). RU486 (Sigma) served as glucocorticoid receptor antagonist. In this experiment,
a single dose of dexamethasone (10 − 6 M) and a single treatment period (48 h) were adopted which is based on our preliminary
experiment. All preadipocytes were cultured in DMEM/F-12 (Invitrogen) plus l-glutamine, penicillin (100 IU/ml), streptomycin (100 IU/ml), and fungizone (4 μg/ml)
at 37°C with 5% CO2.
MTT assay
For cell viability studies, preadipocytes were seeded in 96-well culture plates at
a density of 103/well, and then, 100 μl DMEM/F-12 medium containing 10% FBS was added to each well.
After treatment with 10 − 6 M of dexamethasone for 48 h, the old culture medium was removed, 20 μl of MTT (Keygentec,
Nanjing, China) was added to each well of the 96-well assay plate containing 100 μl
of fresh culture medium, and the cells were cultured for 4 h at 37°C in a humidified,
5% CO2 atmosphere. Afterwards, the absorbance at 490 nm was recorded using a 96-well plate
reader. The viable cell number is proportional to the absorbance value.
TG content determination
The intracellular TG content was measured according to the method of Oil Red-O staining
extraction. Preadipocytes were seeded in 24-well culture plates until 85–90% confluence.
After treatment with 10 − 6 M of dexamethasone for 48 h, the old culture medium was removed. Cells were first
washed with phosphate buffered saline (PBS) for 3 times, fixed with 10% formalin for
5 min, and changed with fixative for 2 h. After fixation, 60% isopropanol (1 ml/hole)
was added to the plate for 30 s. After removing 60% isopropanol, Oil Red-O working
solution (Sunshinebio, Nanjing, China) was added to the plate for 1 h (1 ml/well).
And then, Oil Red-O working solution was removed and 300 μl 100% isopropanol was added
to the plate to extract Oil Red-O. Finally, 100% isopropanol was collected and the
plate was observed under a microscope. A wavelength of 510 nm absorbance was used
with a Microplate reader (Synergy BioTek, Vermont, USA), which can reflect the intracellular
TG content [21]
[22].
RNA extraction and real-time PCR
Total RNA was extracted from homogenised adipose cells using the TRIzol Total RNA
Kit (Invitrogen) and subsequently purified with the RNase-Free DNase Set (Promega,
Madison, WI, USA) according to the manufacturer’s instructions. The total RNA concentration
was then quantified by measuring the absorbance at 260 nm in an Eppendorf BioPhotometer
(Gene Company Ltd., Shanghai, China). The absorption ratios (260/280 nm) for all the
preparations were between 1.8 and 2.0. Two micrograms of total RNA were reverse transcribed
in a final volume of 25 μl with M-MLV reverse transcriptase (Promega) and random hexamer
primers (Sunshinebio, Nanjing, China). Reverse transcription was performed in a Thermal
Cycler PTC0200 (Bio-Rad, Philadelphia, PA, USA).
Real-time PCR was performed in an Mx 3000P (Agilent Technologies, Stratagene, Santa
Clara, CA, USA) with specific primers. All primers were designed and synthesised by
Takara Biotechnology (China; [Table 1]). The results were expressed relative to the number of 18S transcripts used as an
internal control. Mock reverse transcription and no template controls (NTC) were used
to monitor possible contaminations with genomic DNA. Pooled samples, made by mixing
equal cDNA quantities from each sample, were used for optimising the PCR conditions
and generating the standard curves for each target gene. The quality of the PCR products
was checked by 1.4% agarose gel electrophoresis. In all cases, single bands of the
expected size were observed. Melting curve analyses further assessed the specificity
of each PCR product.
Table 1 List of gene specific primers used for q-PCR.
|
Target
|
GenBank accession
|
PCR products (bp)
|
Primer sequences
|
|
Perilipin
|
AY973170
|
119
|
F: 5′-gcctgactttgctggatgg-3′
|
|
|
|
R: 5′-cttggtgctggtgtaggtcttct-3′
|
|
PPAR-γ
|
NM138711
|
210
|
F:5′-gcccttcaccactgttgatt-3′
|
|
|
|
R:5′-gagttggaaggctcttcgtg-3′
|
|
C/EBP-β
|
NM005194
|
158
|
F: 5′-gacaagcacagcgacgagta-3′
|
|
|
|
R: 5′-agctgctccaccttcttctg-3′
|
|
GR
|
AY779185
|
108
|
F: 5′-ccaaactctgccttgtgtgttc-3′
|
|
|
|
R: 5′-tgtgctgtccttccactgct-3′
|
|
FAS
|
EF589048
|
206
|
F: 5′-gtcctgctgaagcctaactc-3′
|
|
|
|
R: 5′-tccttggaaccgtctgtg-3′
|
|
18S rRNA
|
AY265350
|
122
|
F: 5′-cccacggaatcgagaaagag-3′
|
|
|
|
R: 5′-ttgacggaagggcacca-3′
|
Bioinformatics method
The miRNA targets predicted by computer-aided algorithms were obtained from miRGen
(http://www.diana.pcbi.upenn.edu/miRGen.html) [23], TargetScan (http://www.targetscan.org/vert_42/) [24], PicTar (http://pictar.org/) [25], and miRanda (http://www.microrna.org/microrna/).
miRNA real-time PCR quantification
RT-PCR analysis of miRNA expression was performed in an Mx 3000P (Stratagene) with
specific primers ([Table 2]). Briefly, total RNA was extracted from adipocytes using TRIZOL Reagent (Invitrogen)
and subsequently purified with the RNase-Free DNase Set (Promega) according to the
manufacturer’s instructions. The treated total RNA (4 μg) was polyadenylated by poly(A)
polymerase (PAP) at 37°C for 1 h in a 20 μl reaction mixture following the manufacturer’s
directions for the Poly(A) Tailing Kit (AM1350, Ambion, USA) [26]. The tailing reactions contained 4 μg of RNA samples (1 μg/μl), 4 μl of 5×E-PAP
buffer, 2 μl of 25 mM MnCl2, 2 μl of 10 mM ATP, 0.8 μl of E-PAP, and the external controls (E1, E2, and E5) at
0.2 pmol each; this reaction solution was then brought up to a 20 μl final volume
with nuclease-free water. After phenol–chloroform extraction and ethanol precipitation,
the RNAs were dissolved in DEPC-treated water and cDNAs were synthesised from tailing
RNAs using a gene-specific oligo dT-adapter primer (1 μg/µl). Reverse transcriptase
reactions contained 2 μg poly-A tailed RNAs and 1 μl of oligo dT-adapter (1 μg/μl).
The 10 μl reactions were incubated for 5 min at 70°C (RT1). The RT2 reactions consisted
of the entire RT1 reactions, mixed with 5 μl M-MLV 5×buffer (containing 250 mM pH
8.3 Tris-HCl, 15 mM MgCl2, 375 mM KCl, and 50 mM DTT), 1.25 μl 10 mM dNTP, 1 μl M-MLV RNase (200 U/μl), 0.5 μl
RNase inhibitor (40 U/μl). The 25 μl reactions were incubated at 42°C for 1 h and
then at 95°C for 5 min. The 25 μl PCR reactions included 2 μl RT product, 2 μl primers
([Table 2]), 8.5 μl sterile triple distilled H2O, and 12.5 μl SYBR Premix Ex Taq TM (TaKaRa, Tokyo, Japan). The reactions were incubated
in a 96-well optical plate at 95°C for 5 min, followed by 28 cycles at 95°C for 30 s
and 66°C for 30 s. The PCR reactions run on an Mx 3000P (Agilent Technologies) and
analysed using the Mx 3000P System SDS software.
Table 2 The primer sequences of the putative microRNAs for qRT-PCR.
|
microRNA (mature)
|
Accession
|
Chromosome
|
Primer sequence (5′–3′)
|
|
qRT-PCR: quantitative reverse transcription polymerase chain reaction
|
|
miRNA-155
|
MIMAT0017953
|
13
|
uccuacauguuagcauuaaca
|
|
miRNA-455
|
MIMAT0013880
|
12
|
ugaggggcagagagcgagacuuu
|
|
miRNA-423-5p
|
MIMAT0013960
|
1
|
gcaguccaugggcauauacac
|
|
miRNA-374a
|
MIMAT0013913
|
|
uuauaauacaaccugauaagug
|
|
miRNA-374b-5p
|
MIMAT0013915
|
|
auauaauacaaccugcuaagug
|
|
miRNA-191
|
MIMAT0013876
|
13
|
caacggaaucccaaaagcagcug
|
|
miRNA-362
|
MIMAT0017958
|
|
aauccuuggaaccuaggugugagug
|
|
E5 (external reference)
|
|
|
gtgacccacgatgtgtattcgc
|
|
Common downstream primer
|
|
|
tagagtgagtgtagcgagca
|
|
Reverse transcription primer
|
|
|
tagagtgagtgtagcgagcacagaattaatacgactcactatagg(t)16vn
|
E5 small nuclear RNA was used as an external control to normalise RNA input. The Ct
value is defined as the fractional cycle number at which the fluorescence passes the
fixed threshold. The fold change was calculated using the 2–ΔΔCt method, presented as the fold-expression change in dexamethasone-treated adipocytes
relative to their corresponding control adipocytes after normalisation to the endogenous
control. All experiments were performed in triplicate.
Determination of protein expression
One bottle (25 cm2) of frozen adipocytes was extracted with 1 ml lysis buffer containing 100 mM NaCl,
2 mM EDTA, 5% SDS, 0.1 mM Na3VO4, 50 mM NaF, 1 mM benzamidine, 100 μM AEBSF, 10 μg/ml aprotinin and 50 mM HEPES (pH
7.4). The protein content was measured with the BCA Protein Assay Kit (Pierce biotechnology,
Rockford, IL, USA). Forty micrograms of protein extract were mixed with loading buffer
and denatured by boiling for 5 min before being loaded on a 10% SDS-polyacrylamide
gel. After electrophoresis, the proteins were transferred to nitrocellulose membranes
and blocked with 3% BSA in Tween-Tris-buffered saline for 90 min at room temperature.
After repeated washing with Tween-Tris-buffered saline, the membranes were incubated
with the appropriate antibodies. Western blot analysis for detecting C/EBP-β was performed
with a polyclonal antibody (cs-150X, Santa Cruz Technology, CA, USA) at a dilution
of 1:1 000. C/EBP-β was detected at 38 kDa. The PPAR-γ antibody (Bioworld Technology,
MN, USA) was used at a dilution of 1:500. A protein band at 57 kDa was observed. An
antibody against β-actin (Abcam, Cambridge, UK) was used as an internal standard at
a 1:10 000 dilution. Goat anti-rabbit IgG peroxidase-conjugated secondary antibodies
(Bioworld Technology) were used at a dilution of 1:10 000. Finally, the membrane was
washed, and the specific signals were detected by chemiluminescence using the LumiGlo
substrate (SuperSignalWest-PicoTrial Kit, Pierce, Rockford, IL, USA). The experiments
were performed in triplicate.
Plasmid construction
Genomic fragments of porcine miR-374a/b and their precursors of approximately 89 bp
were synthesised by Invitrogen. There is one predicted conserved target site for miR-374a/b
in the 3′-UTR of C/EBP-β (www.targetscan.org). A 389 bp fragment of the C/EBP-β 3′-UTR was amplified by PCR using the primers
5′-CCACAGTGACTCCGGGAAG-3′ and 5′-CGTAGGAACATCTTTAAGCGA-3′. The 389 bp fragment, which
contains a motif for miR-374a/b that is broadly conserved in vertebrates (www.targetscan.org), was cloned downstream of the luciferase gene in the pGL3-Control luciferase reporter
vector. These constructs, named pGL3-control/C/EBP-β, were transfected into HeLa cells.
The PCR products were subcloned into the luciferase reporter pGL3-Control using XbaI
(Invitrogen). Precursor miR-374a/b was annealed using annealing buffer (5×), the miRNA
precursor upstream sequence (50 μM) and the downstream sequence (50 μM). The 50 μl
reaction solutions were incubated in a 96-well optical plate at 95°C for 2 min and
then subjected to touchdown PCR (with decreases of 0.1°C/8 s until 25°C is reached);
subsequently, the PCR products were subcloned into the pSilencer 3.0-H1 siRNA expression
vector using BamHI and HindIII (Invitrogen).
DNA transfection
Approximately 3×104/cm3 HeLa cells were seeded and cultured in 25 cm2 cell culture bottles. When the cells reached 90–95% confluence, they were co-transfected
with 100 ng of pGL3-control/C/EBP-β 3′-UTR fluorescent luciferase reporter plasmid,
10 ng of pRL-TK plasmid (used to normalise for transformation efficiency), or 100 ng
of pSilence 3.1 H1-neo miR-374a/b with lipofectamine 2000 (Invitrogen) according to
the manufacturer’s instructions. Negative controls were co-transfected with 100 ng
of miR-SC, 100 ng of target genes 3′-UTR fluorescent luciferase reporter plasmid and
10 ng of pRL-TK plasmid. At the same time, the miRNA-374a/b inhibitor (Invitrogen)
was added to the medium of the co-transfected cells. After transfection, the cells
were counted, and the cell density was approximately 2×104 cells/cm3. The transfected HeLa cells were incubated at 5% CO2 and 37°C for 24 h.
Dual luciferase activity assay
Twenty-four hours after transfection, firefly and renilla luciferase activities were
measured using a Dual-Luciferase Assay Kit (Promega) with a plate reader (PerkinElmer,
Waltham, MA, USA). The renilla and firefly luciferase signals were detected using
the Veritas Microplate Luminometer (Turner Biosystems, Sunnyvale, CA, USA). The firefly
luciferase signal was normalised to the renilla luciferase signal. The normalised
firefly luciferase activity was compared between miR-374a/b and the miRNA scrambled
control (miR-SC) cells. The results were expressed as relative activity. Each target
construct was tested in triplicate, and the assay was repeated to confirm the results.
Statistical analysis
All data are presented as the mean±SEM. Statistical analyses were carried out with
Statistical Program for Social Sciences (SPSS) software 17.0 for Windows (SPSS Inc.,
Chicago, IL, USA). The differences were tested with a one-way ANOVA. A p-value of
less than 0.05 was considered significant.
Results
Effect of 10 − 6 M dexamethasone on the cell viability and TG deposition of porcine preadipocytes
([Fig. 1]
[2]
[3])
As shown in [Fig. 1], 10 − 6 M dexamethasone had no effect on the viability of porcine preadipocytes compared
with the control group. The same concentration of RU486 showed no differences when
compared with other 3 groups (p>0.05).
Fig. 1 Effect of 10 − 6 M dexamethasone on proliferative activity of porcine preadipocytes. Con: control
group; Dex: 10 − 6 M dexamethasone group; RU486: 10 − 6 M glucocorticoid receptor antagonist group; Dex + RU486: 10 − 6 M dexamethasone and 10 − 6 M glucocorticoid receptor antagonist group. n=6/group.
Fig. 2 Differentiation of pig primary adipocytes and Oil Red-O staining. a The preadipocytes merge more than 80% (×200). b Adipocyte differentiation for 48 h (×400). c Oil Red-O staining with adipocyte, the red parts are lipid droplets (×200).
Fig. 3 Effect of 10 − 6 M dexamethasone on triglyceride deposition of primary cultured adipocyte. Con: control
group; Dex: 10 − 6 M dexamethasone group; RU486: 10 − 6 M glucocorticoid receptor antagonist group; Dex + RU486: 10 − 6 M dexamethasone and 10 − 6 M glucocorticoid receptor antagonist group. Different letter means significant difference,
p<0.05, n=6/group.
Treatment with 10 − 6 M dexamethasone for 48 h significantly increased the TG content when compared with
the control group (p<0.05). However, treatment with only 10 − 6 M RU486 or 10 − 6 M RU486 together with 10 − 6 M dexamethasone did not reverse the increased TG content induced by 10 − 6 M dexamethasone.
Effect of 10 − 6 M dexamethasone on the expression of target genes related to lipid metabolism
As shown in [Fig. 4], the expression of PPAR-γ and perilipin mRNA were significantly increased in the
10 − 6 M dexamethasone group compared to the control group (p<0.05). However, C/EBP-β levels
decreased significantly after 48 h treatment with 10 − 6 M dexamethasone compared with the control group. GR and FAS mRNA expression was not
significantly different between the groups (p>0.05).
Fig. 4 Effect of 10 − 6 M dexamethasone on the expression of target genes related to lipid metabolism in
primary cultured porcine adipocyte. *p<0.05 compared with the CON group, n=6/group.
Effect of 10 − 6 M dexamethasone on PPAR-γ and C/EBP-β protein expression
PPAR-γ protein level was significantly increased in the 10 − 6 M dexamethasone group compared to the control group (p<0.05) ([Fig. 5a]). However, C/EBP-β protein levels were significantly decreased in the 10 − 6 M dexamethasone group compared to the control group ([Fig. 5b]).
Fig. 5 Effect of dexamethasone on PPAR-γ and C/EBP-β protein expression in primary cultured
porcine adipocyte. a PPAR-γ. b C/EBP-β. *p<0.05 compared with the CON group, n=6/group.
Effect of 10 − 6 M dexamethasone on the expression of miRNAs that targets the C/EBP-β 3′-UTR
As shown in [Fig. 6], miRNA-374 (miRNA-374a and miRNA-374b) expression in the 10 − 6 M dexamethasone group was significantly increased (p<0.05) compared to the control
group. However, miRNA-155, 362, 191, 455, and 423-5p expressions were not significantly
different between the 2 groups.
Fig. 6 Effect of dexamethasone on adipocyte miRNAs expression target C/EBP-β of primary
cultured adipocyte at weaning pigs. Values are represented as means±SEM, *p<0.05 compared
with the CON group, n=6/group.
Validation of ssc-miR-374a and ssc-miR-374b targeting C/EBP-β 3′-UTR
miRNA-374a/b had highly conserved sites ([Fig. 7a]) for binding to the 3′-UTR of C/EBP-β. The miR-374a/b-targeted elements in the C/EBP-β
3′-UTR are highly conserved in many mammals, including pig, human, mouse, rat, cow,
sheep, chicken, and dog ([Fig. 7b]). To ascertain whether miR-374a/b are able to recognise the C/EBP-β 3′-UTR, we generated
a luciferase reporter DNA construct containing the 389 bp pig C/EBP-β 3′-UTR with
a putative miR-374a/b binding site and an ssc-miR-374a/b overexpression plasmid. When
the pGL3-Control/C/EBP-β 3′-UTR fluorescent luciferase reporter plasmid and the ssc-miR-374a/b
overexpression vector were co-transfected into HeLa cells, luciferase activity was
significantly suppressed by the ectopic expression of ssc-miR-374a/b after co-transfection
for 24 h. Though overexpression of ssc-miR-374a/b was able to significantly suppress
luciferase activity after the addition of 50 or 100 ng of miRNA-374a/b inhibitor,
adding 150 or 200 ng of miRNA-374a/b inhibitor could significantly reverse this suppression
trend ([Fig. 8]).
Fig. 7 The miR-374a/b target site in the 3′-UTR of C/EBP-β. a The predicted conserved binding site of miR-374a/b in the 3′-UTR of pig C/EBP-β.
b Conservation of the miR-374a/b binding region in the C/EBP-β 3′-UTR among mammals.
The miR-374a/b seed match is highlighted in red (TargetScan). Ss: pig; Hs: human;
Mm: mouse; Ec: horse; Bt: cow; Rn: rat; Gg: chicken.
Fig. 8 Validation of ssc-miR-374a/b targeting of the C/EBP-β 3′-UTR at 24 h after transfection.
a Validation of ssc-miR-374b targeting of the C/EBP-β 3′-UTR. b Validation of ssc-miR-374a targeting of the C/EBP-β 3′-UTR. *p<0.05 compared with
the miRNA-SC group and **p<0.01 compared with the miRNA-SC group, n=3/group.
Discussion
Glucocorticoids are important hormones involved in body metabolism. Regarding its
influence on lipid metabolism, glucocorticoids have been proposed to have both adipogenic
and lipolytic actions within adipose tissue [1]
[2]
[3]
[4]
[5]. Previous studies have demonstrated that glucocorticoids play a direct role in the
formation of cytoplasmic lipid droplets [27]
[28]. The differentiation of 3T3-L1 preadipocytes can be induced by a 2-day treatment
with a factor “cocktail” (DIM) containing synthetic dexamethasone, insulin, the phosphodiesterase
inhibitor methylisobutylxanthine (IBMX), and fetal bovine serum [29]. In the present study, though preadipocyte cell viability was not different from
the control group after treatment with 10 − 6 M dexamethasone for 48 h, yet the TG content was significantly increased [30]. The results indicated that 10 − 6 M dexamethasone contributes to porcine preadipocyte differentiation and lipid droplet
synthesis. Ru486 treatment did not reverse the increase of TG content induced by dexamethasone.
In our preliminary experiment, 10 − 6 M Ru486 can reverse the increase of TG content induced by 10 − 6 M dexamethasone. However, in the current experiment, the inhibitor demonstrated no
effect. The reason may be due to the chemical problem of Ru486 or the pooled preadipocytes
from five 35-day Meishan piglets. Therefore, in the late analysis only control and
dexamethasone groups were used.
Preadipocytes that gradually filled with lipid droplets and differentiated into mature
fat cells with a single chamber were regulated by a number of transcription factors,
including C/EBPs and PPAR-γ. The overexpression of PPAR-γ can promote adipogenesis
[31]
[32]. Compared to wild-type controls, heterozygous PPAR-γ-deficient mice show decreased
fat mass [17]. In the current study, PPAR-γ mRNA and protein expression was significantly upregulated
after treatment with 10 − 6 M dexamethasone for 48 h. This finding is consistent with previous reports demonstrating
that dexamethasone induces preadipocyte recruitment and increases PPAR-γ protein expression
in porcine stromal-vascular (S-V) cells [6]. The perilipins are the most abundant proteins at the surfaces of lipid droplets
in adipocytes, which play a role in regulating the packaging and storage of neutral
lipids [33]
[34]
[35]. Further studies have shown that PPAR-γ is an important transcriptional factor for
perilipin, and the upstream sequence of the perilipin promoter contains a PPRE. Previous
studies have shown that treating differentiated 3T3-L1 adipocytes with a PPAR-γ agonist
significantly augments perilipin mRNA expression [36]
[37]. In the current study, perilipin mRNA expression was significantly increased in
the 10 − 6 M dexamethasone treatment group compared to the control group.
C/EBP-β plays an important role in the induction of PPAR-γ expression and adipogenesis.
Wiper-Bergeron showed that glucocorticoid-stimulated preadipocyte differentiation
is mediated through the acetylation of C/EBP-β [38]. C/EBPs family includes 6 kinds of transcription factors, and C/EBP-α, C/EBP-β,
C/EBP-δ, and C/EBP-ζ can expressed in adipose tissue [39]. Expression of various transcription factors in adipocyte differentiation process
has a time sequence. In the current study, C/EBP-β expression significantly decreased
after 48-h treatment with 10 − 6 M dexamethasone. Previous studies have shown that the expression of C/EBP-β usually
occurs at a very early stage of adipocyte differentiation, which is followed by the
induction of C/EBP-α and PPAR-γ, which promotes differentiation by activating adipose-specific
gene expression [40]
[41]. These results show that there is a time difference between PPAR-γ and C/EBP-β expression.
When the adipose differentiation process progresses, C/EBP-β expression shows a declining
trend, while PPAR-γ expression gradually increases [42]. Therefore, the present results illustrate that after treatment with 10 − 6 M dexamethasone for 48 h, the differentiation of porcine preadipocytes has reached
a late stage of differentiation.
It is largely unknown which factors induce the C/EBP-β expression decrease as the
adipose differentiation process progresses. In recent years, it has been shown that
miRNAs are involved in the regulatory network of many biological processes through
the post-transcriptional regulation of transcription factors. Several miRNAs were
reported to be expressed in mammalian adipocytes and seem to play a role in the regulation
of adipogenesis [15]. In the present study, we identified seven candidates of C/EBP-β-targeting miRNAs
by bioinformatic analyses. Among the predicated miRNAs, only miRNA-374a and miRNA-374b
were found to be upregulated in the 10 − 6 M dexamethasone treatment cells. In the previous study, miRNA-374a/b was reported
to serve as a prognostic marker for patient risk stratification at early stages of
non-small cell lung cancer progression [43], and miR-374 has also been found to respond to primary infections of self-healing
Plasmodium chabaudi malaria in female C57BL/6 mice [44]. miR-374a could be involved in the phospho-ΔNp63α-dependent regulation of autophagic
signalling and the control cell death of squamous cell carcinoma (SCC) cells [45]. The upregulation of miR-374a is thought to participate in the carcinogenesis of
the colon without lymph node metastasis [46]. miR-374b expression in seminal plasma could also provide a novel, noninvasive approach
for diagnosing male infertility [47]. Referring to the role of miR-374 in the lipid metabolism, our previously reports
demonstrated that microRNA-374b mediate the effect of maternal dietary protein on
offspring lipid metabolism in Meishan pigs by targeting on the C/EBP-β [48]. In the present study, both microRNA-374b and microRNA-374a were shown to participate
in the regulation of adipocyte differentiation. Luciferase reporter assays were performed
to fully validate the predicted miRNA-mRNA interactions. In the present study, miR-374a/b
overexpression significantly reduced the activity of a luciferase reporter containing
the C/EBP-β 3′-UTR after co-transfection for 24 h, and a miRNA-374a/b inhibitor could
significantly reverse this suppression. These results indicate that miR-374a/b can
directly recognise and bind to the 3′-UTR of C/EBP-β and suppress C/EBP-β expression.
In contrast, miR-374a/b did not alter the activity of a luciferase reporter that has
no C/EBP-β 3′-UTR (data not shown).
In conclusion, the present study showed that treatment with 10 − 6 M dexamethasone promoted lipid accumulation in primary porcine preadipocytes. The
expression response of PPAR-γ and C/EBP-β was different after 48-h treatment. miR-374a/b
may be involved in the decrease of C/EBP-β expression. Though the reason why miR-374a/b
increased during adipocyte maturation still needs further study. These results provide
a possibly new target for the regulation of porcine fat deposition.
